Previous Contig 002832:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS001F05Sequence609002832 (3)pir|C84922|C849222e-12probable protein kinase [imported] - Arabidopsis thaliana>gb:AC006072_1533410 Ar
JMFS015B01Sequence584002832 (3)pir|C84922|C849222e-10probable protein kinase [imported] - Arabidopsis thaliana>gb:AC006072_1533410 Ar
JMSF050E15Sequence715002832 (3)pir|C84922|C849221e-26probable protein kinase [imported] - Arabidopsis thaliana>gb:AC006072_1533410 Ar783024412pir|C84922|C849228e-29probable protein kinase [imported] - Arabidopsis thaliana>gb:AC006072_1533410 Ar

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF050E15+ AAGGGGAGTTGTTGTCGAGAGACTGATTNCAAGCGGAGACGACG
                      ____________________________________________________________
consensus AAGGGGAGTTGTTGTCGAGAGACTGATTNCAAGCGGAGACGACG
 
. : . : . : . : . : . :
JMSF050E15+ CTGGAGAGGGCGGCGGCGGAGACGTTGGACTCGAATTCGGGTCGGGTCGTGATGTTCATG
                      ____________________________________________________________
consensus CTGGAGAGGGCGGCGGCGGAGACGTTGGACTCGAATTCGGGTCGGGTCGTGATGTTCATG
 
. : . : . : . : . : . :
JMSF050E15+ CAACCCTGAGAGATCCAGGTGGTTTCGAAGCCGCAGCGGCGGCGGATATCGAAGCCGGGG
JMFS001F05+ AAGCCGGGG
                      ____________________________________________________________
consensus CAACCCTGAGAGATCCAGGTGGTTTCGAAGCCGCAGCGGCGGCGGATATCGAAGCCGGGG
 
. : . : . : . : . : . :
JMSF050E15+ AGGAAAGCGTTGACTACGGCCTGATAAGAGTCCCAGCAAGATTGCGCCGAGAGCAAAGGC
JMFS015B01+ CGGCCTGATAAGAGTCCCAGCAAGATTGCGCCGAGAGCAAAGGC
JMFS001F05+ AGGAAAGCGTTGACTACGGCCTGATAAGAGTCCCAGCAAGATTGCGCCGAGAGCAAAGGC
                      ____________________________________________________________
consensus AGGAAAGCGTTGACTACGGCCTGATAAGAGTCCCAGCAAGATTGCGCCGAGAGCAAAGGC
 
. : . : . : . : . : . :
JMSF050E15+ GGGAGGAAGGAGTTGGTGCGGCGGAGATAGTCGGACTGGACGAGGCGGAGGCCCTGAAGG
JMFS015B01+ GGGAGGAAGGAGTTGGTGCGGCGGAGATAGTCGGACTGGACGAGGCGGAGGCCCTGAAGG
JMFS001F05+ GGGAGGAAGGAGTTGGTGCGGCGGAGATAGTCGGACTGGACGAGGCGGAGGCCCTGAAGG
                      ____________________________________________________________
consensus GGGAGGAAGGAGTTGGTGCGGCGGAGATAGTCGGACTGGACGAGGCGGAGGCCCTGAAGG
 
. : . : . : . : . : . :
JMSF050E15+ ATGTACTGGCAATTCGTTGTAGTGTTCAAAGTCGGCCGCGAGGAGCTCTGCTCCACCAAT
JMFS015B01+ ATGTACTGGCAATTCGTTGTAGTGTTCAAAGTCGGCCGCGAGGAGCTCTGCTCCACCAAT
JMFS001F05+ ATGTACTGGCAATTCGTTGTAGTGTTCAAAGTCGGCCGCGAGGAGCTCTGCTCCACCAAT
                      ____________________________________________________________
consensus ATGTACTGGCAATTCGTTGTAGTGTTCAAAGTCGGCCGCGAGGAGCTCTGCTCCACCAAT
 
. : . : . : . : . : . :
JMSF050E15+ CTCCGAAGAACATCGAAATCCAGAGGACACGACGAAGAAGAAGAATTGGTCTGTTGCTGC
JMFS015B01+ CTCCGAAGAACATCGAAATCCAGAGGACACGACGAAGAAGAAGAATTGGTCTGTTGCTGC
JMFS001F05+ CTCCGAAGAACATCGAAATCCAGAGGACACGACGAAGAAGAAGAATTGGTCTGTTGCTGC
                      ____________________________________________________________
consensus CTCCGAAGAACATCGAAATCCAGAGGACACGACGAAGAAGAAGAATTGGTCTGTTGCTGC
 
. : . : . : . : . : . :
JMSF050E15+ AGTGAAACGTCGCTAACTGAAAGGGAAGGAGAAGCGATTTTAAAGAAGATAATGAAGAAG
JMFS015B01+ AGTGAAACGTCGCTAACTGAAAGGGAAGGAGAAGCGATTTTAAAGAAGATAATGAAGAAG
JMFS001F05+ AGTGAAACGTCGCTAACTGAAAGGGAAGGAGAAGCGATTTTAAAGAAGATAATGAAGAAG
                      ____________________________________________________________
consensus AGTGAAACGTCGCTAACTGAAAGGGAAGGAGAAGCGATTTTAAAGAAGATAATGAAGAAG
 
. : . : . : . : . : . :
JMSF050E15+ ATGATGTAAATCGTTACTTGCATCATTCTATTTTCAGTTTTGTTAGTTGGGGGCGGGGGA
JMFS015B01+ ATGATGTAAATCGTTACTTGCATCATTCTATTTTCAGTTTTGTTAGTTGGGGGCGGGGGA
JMFS001F05+ ATGATGTAAATCGTTACTTGCATCATTCTATTTTCAGTTTTGTTAGTTGGGGGCGGGGGA
                      ____________________________________________________________
consensus ATGATGTAAATCGTTACTTGCATCATTCTATTTTCAGTTTTGTTAGTTGGGGGCGGGGGA
 
. : . : . : . : . : . :
JMSF050E15+ ATTATGGTTCACGGAGGCGAGTAAGAATCTGAAACAGAGAAACGGGGGATTGAGGGAGGC
JMFS015B01+ ATTATGGTTCACGGAGGCGAGTAAGAATCTGAAACAGAGAAACGGGGGATTGAGGGAGGC
JMFS001F05+ ATTATGGTTCACGGAGGCGAGTAAGAATCTGAAACAGAGAAACGGGGGATTGAGGGAGGC
                      ____________________________________________________________
consensus ATTATGGTTCACGGAGGCGAGTAAGAATCTGAAACAGAGAAACGGGGGATTGAGGGAGGC
 
. : . : . : . : . : . :
JMSF050E15+ GGCGGGGGAGACGGTGGTGGGTGGGAGGGGAGGATTGACTTTGCGCTGATCATTCATGGA
JMFS015B01+ GGCGGGGGAGACGGTGGTGGGTGGGAGGGGAGGATTGACTTTGCGCTGATCATTCATGGA
JMFS001F05+ GGCGGGGGAGACGGTGGTGGGTGGGAGGGGAGGATTGACTTTGCGCTGATCATTCATGGA
                      ____________________________________________________________
consensus GGCGGGGGAGACGGTGGTGGGTGGGAGGGGAGGATTGACTTTGCGCTGATCATTCATGGA
 
. : . : . : . : . : . :
JMSF050E15+ AATGGAAATCTGGGTCGCCAAAATGGAGTAGCTAGCGAAACTTGAATATTGAGTTGGTTG
JMFS015B01+ AATGGAAATCTGGGTCGCCAAAATGGAGTAGCTAGCGAAACTTGAATATTGAGTTGGTTG
JMFS001F05+ AATGGAAATCTGGGTCGCCAAAATGGAGTAGCTAGCGAAACTTGAATATTGAGTTGGTTG
                      ____________________________________________________________
consensus AATGGAAATCTGGGTCGCCAAAATGGAGTAGCTAGCGAAACTTGAATATTGAGTTGGTTG
 
. : . : . : . : . : . :
JMSF050E15+ TACTGGATTT
JMFS015B01+ TACTGGATTTAATTATTTGATTCAGAGACGACGATCTTGAAGAAAAGCTCTCTCACTAAA
JMFS001F05+ TACTGGATTTAATTATTTGATTCAGAGACGACGATCTTGAAGAAAAGCTCTCTCACTAAA
                      ____________________________________________________________
consensus TACTGGATTTAATTATTTGATTCAGAGACGACGATCTTGAAGAAAAGCTCTCTCACTAAA