Previous Contig 002830:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013G21Sequence570002830 (15)
JMFF019H04Sequence570002830 (15)754009112 (6)gb:AY227247_15910621e-08Arabidopsis thaliana SAC domain protein 4 (SAC4) mRNA, complete cds.
JMFF028C02Sequence513002830 (15)687009112 (6)
JMFF033F16Sequence421002830 (15)723009112 (6)gb:AY227247_15910625e-09Arabidopsis thaliana SAC domain protein 4 (SAC4) mRNA, complete cds.
JMFF037L05Sequence561002830 (15)742021526gb:AY227247_15910628e-12Arabidopsis thaliana SAC domain protein 4 (SAC4) mRNA, complete cds.
JMFS001D06Sequence611002830 (15)
JMFS010E02Sequence632002830 (15)gb:AP000600_18203842e-67Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MAG2.
JMFS093F09Sequence597002830 (15)
JMFS100A11Sequence616002830 (15)gb:AP000600_18203841e-49Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MAG2.
JMFS124G03Sequence565002830 (15)
JMSF001H22Sequence196002830 (15)765009112 (6)gb:AY227247_15910625e-09Arabidopsis thaliana SAC domain protein 4 (SAC4) mRNA, complete cds.
JMSF005H19Sequence360002830 (15)
JMSF027G10Sequence652002830 (15)gb:AC079633_17326510.045Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0032G08, from 756010356 (27)pir|S00443|S00443e-112chlorophyll a/b-binding protein type I precursor (cab-6A) - tomato>gb:TOMCAB_172
JMSF035B13Sequence674002830 (15)gb:AC079633_17326519e-06Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0032G08, from 735009112 (6)gb:AY227247_15910625e-09Arabidopsis thaliana SAC domain protein 4 (SAC4) mRNA, complete cds.
JMSF052P05Sequence569002830 (15)663010356 (27)pir|S00443|S004433e-81chlorophyll a/b-binding protein type I precursor (cab-6A) - tomato>gb:TOMCAB_172

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS010E02+ AC
                      ____________________________________________________________
consensus AC
 
. : . : . : . : . : . :
JMFS100A11+ AGCTAAAGAAGAA
JMFS010E02+ ATTATCACACATGTTTTTCTGTAGACTCCTCATTATGTGGTATGAATAGCTAAAGAAGAA
                      ____________________________________________________________
consensus ATTATCACACATGTTTTTCTGTAGACTCCTCATTATGTGGTATGAATAGCTAAAGAAGAA
 
. : . : . : . : . : . :
JMFS100A11+ GTCC-TTGGAAGATCCACCATACGCATAAGCTTCTTATATCTGTATTCACTCTTATAATT
JMFS010E02+ GTCCTTTGTAAGATCCACCATACGCATAAGCTTCTTATATCTGTATTCACTCTTATAATT
                      ____________________________________________________________
consensus GTCCTTTGTAAGATCCACCATACGCATAAGCTTCTTATATCTGTATTCACTCTTATAATT
 
. : . : . : . : . : . :
JMFS100A11+ AGCCATCTTTGACTGAACATAAGAACTTGGAAGTGGGATTATCTCGCTCTTAGAGATTGC
JMFS010E02+ AGCCATCTTTGACTGAACATAAGAACTTGGAAGTGGGATTATCTCGCTCTTAGAGATTGC
                      ____________________________________________________________
consensus AGCCATCTTTGACTGAACATAAGAACTTGGAAGTGGGATTATCTCGCTCTTAGAGATTGC
 
. : . : . : . : . : . :
JMFS100A11+ ATATATGGTATGACCACAAATGTCACCAATCTGCCTCCTCTTTGTAATAAGCAACATGTA
JMFS010E02+ ATATATGGTATGACCACAAATGTCACCAATCTGCCTCCTCTTTGTAATAAGCAACATGTA
                      ____________________________________________________________
consensus ATATATGGTATGACCACAAATGTCACCAATCTGCCTCCTCTTTGTAATAAGCAACATGTA
 
. : . : . : . : . : . :
JMFS100A11+ GTAAGGCCCCAAAAATTTTATGAACCCAACAATGCCATAACATGTGGTGACAAACTTCAA
JMFS010E02+ GTAAGGCCCCAAAAATTTTATGAACCCAACAATGCCATAACATGTGGTGACAAACTTCAA
                      ____________________________________________________________
consensus GTAAGGCCCCAAAAATTTTATGAACCCAACAATGCCATAACATGTGGTGACAAACTTCAA
 
. : . : . : . : . : . :
JMFS100A11+ TCCTCCTGTAGATCTGTTTCCTTCATGTATTCTTCCCAACAAATCAGAGCACTCAATTGC
JMFS010E02+ TCCTCCTGTAGATCTGTTTCCTTCATGTATTCTTCCCAACAAATCAGAGCACTCAATTGC
                      ____________________________________________________________
consensus TCCTCCTGTAGATCTGTTTCCTTCATGTATTCTTCCCAACAAATCAGAGCACTCAATTGC
 
. : . : . : . : . : . :
JMFS100A11+ AGTGTAAGTGGTAGAATCTTCACGAATGTTAAGTTCAGAAGGCTCCGTCCTATCAATTTT
JMFS010E02+ AGTGTAAGTGGTAGAATCTTCACGAATGTTAAGTTCAGAAGGCTCCGTCCTATCAATTTT
                      ____________________________________________________________
consensus AGTGTAAGTGGTAGAATCTTCACGAATGTTAAGTTCAGAAGGCTCCGTCCTATCAATTTT
 
. : . : . : . : . : . :
JMFS100A11+ CAAAACTCTCCAGTACGTTCTACTCTTGTTCCTCCCTATCATGTA
JMFS010E02+ CAAAACTCTCCAGTACGTTCTACTCTTGTTCCTCCCTATCATGTAAAACTTCGAGCGGGT
JMSF035B13+ TCTCCAGTACGTTCTACTCTTGTTCCTCCCTATCATGTAAAACTTCGAGCGGGT
JMSF027G10+ TTCCTCCCTATCATGTAAAACTTCGAGCGGGT
                      ____________________________________________________________
consensus CAAAACTCTCCAGTACGTTCTACTCTTGTTCCTCCCTATCATGTAAAACTTCGAGCGGGT
 
. : . : . : . : . : . :
JMFS010E02+ TTCGTATAGACGAAATTTCTCCATAAACCCCTCCTGAGGCGGATCTGAAGGAGACGACAG
JMSF035B13+ TTCGTATAGACGAAATTTCTCCATAAACCCCTCCTGAGGCGGATCTGAAGGAGACGACAG
JMFF019H04+ CTGAAGGAGACGACAG
JMFF013G21+ CTGAAGGAGACGACAG
JMSF027G10+ TTCGTATAGACGAAATTTCTCCATAAACCCCTCCTGAGGCGGATCTGAAGGAGACGACAG
JMFS093F09+ GAAGGAGACGACAG
JMSF052P05+ AGACGACAG
JMFF037L05+ GACAG
JMFS001D06+ AGGAGACGACAG
                      ____________________________________________________________
consensus TTCGTATAGACGAAATTTCTCCATAAACCCCTCCTGAGGCGGATCTGAAGGAGACGACAG
 
. : . : . : . : . : . :
JMFS010E02+ GCATTGCTGCTCTCCTTTCCCATTGAAAAAGTGCGTTTCCGGCGGAGAAGGGGGTGGCTC
JMSF035B13+ GCATTGCTGCTCTCCTTTCCCATTGAAAAAGTGCGTTTCCGGCGGAGAAGGGGGTGGCTC
JMFF019H04+ GCATTGCTGCTCTCCTTTCCCATTGAAAAAGTGCGTTTCCGGCGGAGAAGGGGGTGGCTC
JMFF028C02+ CGGAGAAGGGGGTGGCTC
JMFF013G21+ GCATTGCTGCTCTCCTTTCCCATTGAAAAAGTGCGTTTCCGGCGGAGAAGGGGGTGGCTC
JMSF027G10+ GCATTGCTGCTCTCCTTTCCCATTGAAAAAGTGCGTTTCCGGCGGAGAAGGGGGTGGCTC
JMFS093F09+ GCATTGCTGCTCTCCTTTCCCATTGAAAAAGTGCGTTTCCGGCGGAGAAGGGGGTGGCTC
JMSF052P05+ GCATTGCTGCTCTCCTTTCCCATTGAAAAAGTGCGTTTCCGGCGGAGAAGGGGGTGGCTC
JMFS124G03+ TCCTTTCCCATTGAAAAAGTGCGTTTCCGGCGGAGAAGGGGGTGGCTC
JMFF037L05+ GCATTGCTGCTCTCCTTTCCCATTGAAAAAGTGCGTTTCCGGCGGAGAAGGGGGTGGCTC
JMFS001D06+ GCATTGCTGCTCTCCTTTCCCATTGAAAAAGTGCGTTTCCGGCGGAGAAGGGGGTGGCTC
                      ____________________________________________________________
consensus GCATTGCTGCTCTCCTTTCCCATTGAAAAAGTGCGTTTCCGGCGGAGAAGGGGGTGGCTC
 
. : . : . : . : . : . :
JMFS010E02+ GTT-CCCTGAAGCAGCCA-TGGCGGTTAAGCA
JMSF035B13+ GTT-CCCTGAAGCAGCCATTGGCGGTTAAGCAGATCCCCCGAACAAACTCAATGAATCCC
JMFF019H04+ GTT-CCCTGAAGCAGCCATTGGCGGTTAAGCAGATCCCCCGAACAAACTCAATGAATCCC
JMFF028C02+ GTTCCCCTGAAGCAGCCATTGGCGGTTAAGCAGATCCCCCGAACAAACTCAATGAATCCC
JMFF013G21+ GTT-CCCTGAAGCAGCCATTGGCGGTTAAGCAGATCCCCCGAACAAACTCAATGAATCCC
JMSF027G10+ GTT-CCCTGAAGCAGCCATTGGCGGTTAAGCAGATCCCCCGAACAAACTCAATGAATCCC
JMFS093F09+ GTT-CCCTGAAGCAGCCATTGGCGGTTAAGCAGATCCCCCGAACAAACTCAATGAATCCC
JMSF052P05+ GTT-CCCTGAAGCAGCCATTGGCGGTTAAGCAGATCCCCCGAACAAACTCAATGAATCCC
JMFS124G03+ GTT-CCCTGAAGCAGCCATTGGCGGTTAAGCAGATCCCCCGAACAAACTCAATGAATCCC
JMFF037L05+ GTT-CCCTGAAGCAGCCATTGGCGGTTAAGCAGATCCCCCGAACAAACTCAATGAATCCC
JMFS001D06+ GTT-CCCTGAAGCAGCCATTGGCGGTTAAGCAGATCCCCCGAACAAACTCAATGAATCCC
                      ____________________________________________________________
consensus GTT-CCCTGAAGCAGCCATTGGCGGTTAAGCAGATCCCCCGAACAAACTCAATGAATCCC
 
. : . : . : . : . : . :
JMSF035B13+ GAGCCGAGCCAGCCACCGGGCCAGGGAATCAACTGCTCCAGCATTCAATTCCAAAATTCA
JMFF019H04+ GAGCCGAGCCAGCCACCGGGCCAGGGAATCAACTGCTCCAGCACTCAATTCCAAAATTCA
JMFF028C02+ GAGCCGAGCCAGCCACCGGGCCAGGGAATCAACTGCTCCAGCACTCAATTCCAAAATTCA
JMFF013G21+ GAGCCGAGCCAGCCACCGGGCCAGGGAATCAACTGCTCCAGCACTCAATTCCAAAATTCA
JMSF027G10+ GAGCCGAGCCAGCCACCGGGCCAGGGAATCAACTGCTCCAGCATTCAATTCCAAAATTCA
JMFS093F09+ GAGCCGAGCCAGCCACCGGGCCAGGGAATCAACTGCTCCAGCATTCAATTCCAAAATTCA
JMSF052P05+ GAGCCGAGCCAGCCACCGGGCCAGGGAATCAACTGCTCCAGCATTCAATTCCAAAATTCA
JMFS124G03+ GAGCCGAGCCAGCCACCGGGCCAGGGAATCAACTGCTCCAGCATTCAATTCCAAAATTCA
JMFF037L05+ GAGCCGAGCCAGCCACCGGGCCAGGGAATCAACTGCTCCAGCATTCAATTCCAAAATTCA
JMFF033F16+ CGGGCCAGGGAATCAANTGCTCCAGCATTCAATTCCAAAATTCA
JMFS001D06+ GAGCCGAGCCAGCCACCGGGCCAGGGAATCAACTGCTCCAGCATTCAATTCCAAAATTCA
                      ____________________________________________________________
consensus GAGCCGAGCCAGCCACCGGGCCAGGGAATCAACTGCTCCAGCATTCAATTCCAAAATTCA
 
. : . : . : . : . : . :
JMSF035B13+ AAATCTCCAATCTACCAACTGGTGCATATAAACAAACCCACACGCATCATCATCCCCGTC
JMFF019H04+ AAATCTCCAATCTACCAACTGGTGCATATAAACAAACCCACACGCATCATCATCCCCGTC
JMFF028C02+ AAATCTCCAATCTACCAACTGGTGCATATAAACAAACCCACACGCATCATCATCCCCGTC
JMSF001H22+ GTGCATATAAACAAACCCACACGCATCATCATCCCCGTC
JMFF013G21+ AAATCTCCAATCTACCAACTGGTGCATATAAACAAACCCACACGCATCATCATCCCCGTC
JMSF027G10+ AAATCTCCAATCTACCAACTGGTGCATATAAACAAACCCACACGCATCATCATCCCCGTC
JMFS093F09+ AAATCTCCAATCTACCAACTGGTGCATATAAACAAACCCACACGCATCATCATCCCCGTC
JMSF052P05+ AAATCTCCAATCTACCAACTGGTGCATATAAACAAACCCACACGCATCATCATCCCCGTC
JMFS124G03+ AAATCTCCAATCTACCAACTGGTGCATATAAACAAACCCACACGCATCATCATCCCCGTC
JMFF037L05+ AAATCTCCAATCTACCAACTGGTGCATATAAACAAACCCACACGCATCATCATCCCCGTC
JMFF033F16+ AAATCTCCAATCTACCAACTGGTGCATATAAACAAACCCACACGCATCATCATCCCCGTC
JMSF005H19+ CTGGTGCATATAAACAAACCCACACGCATCATCATCCCCGTC
JMFS001D06+ AAATCTCCAATCTACCAACTGGTGCATATAAACAAACCCACACGCATCATCATCCCCGTC
                      ____________________________________________________________
consensus AAATCTCCAATCTACCAACTGGTGCATATAAACAAACCCACACGCATCATCATCCCCGTC
 
. : . : . : . : . : . :
JMSF035B13+ TGTTGCTTCAGATGCAGCATTTTCCGTTGTATCCTCAAATCAACACGTGCTTGAGTCACT
JMFF019H04+ TGTTGCTTCAGATGCAGCATTTTCCGTTGTATCCTCAAATCAACACGTGCTTGAGTCACT
JMFF028C02+ TGTTGCTTCAGATGCAGCATTTTCCGTTGTATCCTCAAATCAACACGTGCTTGAGTCACT
JMSF001H22+ TGTTGCTTCAGATGCAGCATTTTCCGTTGTATCCTCAAATCAACACGTGCTTGAGTCACT
JMFF013G21+ TGTTGCTTCAGATGCAGCATTTTCCGTTGTATCCTCAAATCAACACGTGCTTGAGTCACT
JMSF027G10+ TGTTGCTTCAGATGCAGCATTTTCCGTTGTATCCTCAAATCAACACGTGCTTGAGTCACT
JMFS093F09+ TGTTGCTTCAGATGCAGCATTTTCCGTTGTATCCTCAAATCAACACGTGCTTGAGTCACT
JMSF052P05+ TGTTGCTTCAGATGCAGCATTTTCCGTTGTATCCTCAAATCAACACGTGCTTGAGTCACT
JMFS124G03+ TGTTGCTTCAGATGCAGCATTTTCCGTTGTATCCTCAAATCAACACGTGCTTGAGTCACT
JMFF037L05+ TGTTGCTTCAGATGCAGCATTTTCCGTTGTATCCTCAAATCAACACGTGCTTGAGTCACT
JMFF033F16+ TGTTGCTTCAGATGCAGCATTTTCCGTTGTATCCTCAAATCAACACGTGCTTGAGTCACT
JMSF005H19+ TGTTGCTTCAGATGCAGCATTTTCCGTTGTATCCTCAAATCAACACGTGCTTGAGTCACT
JMFS001D06+ TGTTGCTTCAGATGCAGCATTTTCCGTTGTATCCTCAAATCAACACGTGCTTGAGTCACT
                      ____________________________________________________________
consensus TGTTGCTTCAGATGCAGCATTTTCCGTTGTATCCTCAAATCAACACGTGCTTGAGTCACT
 
. : . : . : . : . : . :
JMSF035B13+ CCCAACCCTAACTCCTGTATCTACGCGTATATAGAAACGAAAACGGAACTTGAGAAACAC
JMFF019H04+ CCCAACCCTAACTCCTGTATCTACGCGTATATAGAAACGAAAACGGAACTTGAGAAACAC
JMFF028C02+ CCCAACCCTAACTCCTGTATCTACGCGTATATAGAAACGAAAACGGAACTTGAGAAACAC
JMSF001H22+ CCCAACCCTAACTCCTGTATCTACGCGTATATAGAAACGAAAACGGAACTTGAGAAACAC
JMFF013G21+ CCCAACCCTAACTCCTGTATCTACGCGTATATAGAAACGAAAACGGAACTTGAGAAACAC
JMSF027G10+ CCCAACCCTAACTCCTGTATCTACGCGTATATAGAAACGAAAACGGAACTTGAGAAACAC
JMFS093F09+ CCCAACCCTAACTCCTGTATCTACGCGTATATAGAAACGAAAACGGAACTTGAGAAACAC
JMSF052P05+ CCCAACCCTAACTCCTGTATCTACGCGTATATAGAAACGAAAACGGAACTTGAGAAACAC
JMFS124G03+ CCCAACCCTAACTCCTGTATCTACGCGTATATAGAAACGAAAACGGAACTTGAGAAACAC
JMFF037L05+ CCCAACCCTAACTCCTGTATCTACGCGTATATAGAAACGAAAACGGAACTTGAGAAACAC
JMFF033F16+ CCCAACCCTAACTCCTGTATCTACGCGTATATAGAAANGAAAACGGAACTTGAGAAACAC
JMSF005H19+ CCCAACCCTAACTCCTGTATCTACGCGTATATAGAAACGAAAACGGAACTTGAGAAACAC
JMFS001D06+ CCCAACCCTAACTCCTGTATCTACGCGTATATAGAAACGAAAACGGAACTTGAGAAACAC
                      ____________________________________________________________
consensus CCCAACCCTAACTCCTGTATCTACGCGTATATAGAAACGAAAACGGAACTTGAGAAACAC
 
. : . : . : . : . : . :
JMSF035B13+ CTCCCGATCTCTGACGATCAAACAATATGCAACGCCAAATCTAAACCCTGAACAATTACA
JMFF019H04+ CTCCCGATCTCTGACGATCAAACAATATGCAACGCCAAATCTAAACCCTGAACAATTACA
JMFF028C02+ CTCCCGATCTCTGACGATCAAACAATATGCAACGCCAAATCTAAACCCTGAACAATTACA
JMSF001H22+ CTCCCGATCTCTGACGATCAAACAATATGCAACGCC
JMFF013G21+ CTCCCGATCTCTGACGATCAAACAATATGCAACGCCAAATCTAAACCCTGAACAATTACA
JMSF027G10+ CTCCCGATCTCTGACGATCAAACAATATGCAACGCCAAATCTAAACCCTGAACAATTACA
JMFS093F09+ CTCCCGATCTCTGACGATCAAACAATATGCAACGCCAAATCTAAACCCTGAACAATTACA
JMSF052P05+ CTCCCGATCTCTGACGATCAAACAATATGCAACGCCAAATCTAAACCCTGAACAATTACA
JMFS124G03+ CTCCCGATCTCTGACGATCAAACAATATGCAACGCCAAATCTAAACCCTGAACAATTACA
JMFF037L05+ CTCCCGATCTCTGACGATCAAACAATATGCAACGCCAAATCTAAACCCTGAACAATTACA
JMFF033F16+ CTCCCGATCTCTGACGATCAAACAATATGCAACGCCAAATNTAAACCCTGAACAATTACA
JMSF005H19+ CTCCCGATCTCTGACGATCAAACAATATGCAACGCCAAATCTAAACCCTGAACAATTACA
JMFS001D06+ CTCCCGATCTCTGACGATCAAACAATATGCAACGCCAAATCTAAACCCTGAACAATTACA
                      ____________________________________________________________
consensus CTCCCGATCTCTGACGATCAAACAATATGCAACGCCAAATCTAAACCCTGAACAATTACA
 
. : . : . : . : . : . :
JMSF035B13+ CGGAATATATATAGATAACAAATACAGAAAATGAAGGACAAAAGAAAATATGAAGTGTGA
JMFF019H04+ CGGAATATATATAGATAACAAATACAGAAAATGAAGGACAAAAGAAAATATGAAGTGTGA
JMFF028C02+ CGGAATATATATAGATAACAAATACAGAAAATGAAGGACAAAAGAAAATATGAAGTGTGA
JMFF013G21+ CGGAATATATATAGATAACAAATACAGAAAATGAAGGACAAAAGAAAATATGAAGTGTGA
JMSF027G10+ CGGAATATATATAGATAACAAATACAGAAAATGAAGGACAAAAGAAAATATGAAGTGTGA
JMFS093F09+ CGGAATATATATAGATAACAAATACAGAAAATGAAGGACAAAAGAAAATATGAAGTGTGA
JMSF052P05+ CGGAATATATATAGATAACAAATACAGAAAATGAAGGACAAAAGAAAATATGAAGTGTGA
JMFS124G03+ CGGAATATATATAGATAACAAATACAGAAAATGAAGGACAAAAGAAAATATGAAGTGTGA
JMFF037L05+ CGGAATATATATAGATAACAAATACAGAAAATGAAGGACAAAAGAAAATATGAAGTGTGA
JMFF033F16+ CGGAATATATATAGATAACAAATACAGAAAATGAAGGACAAAAGAAAATATGAAGTGTGA
JMSF005H19+ CGGAATATATATAGATAACAAATACAGAAAATGAAGGACAAAAGAAAATATGAAGTGTGA
JMFS001D06+ CGGAATATATATAGATAACAAATACAGAAAATGAAGGACAAAAGAAAATATGAAGTGTGA
                      ____________________________________________________________
consensus CGGAATATATATAGATAACAAATACAGAAAATGAAGGACAAAAGAAAATATGAAGTGTGA
 
. : . : . : . : . : . :
JMSF035B13+ TTATCAGTAGGGATGAAGAGGTCGAAATCAAACAAAAATGTGGGAAGTTCTAGAGAAGAG
JMFF019H04+ TTATCAGTAGGGATGAAGAGGTCGAAATCAAACAAAAATGTGGGAAGTTCTAGAGAAGAG
JMFF028C02+ TTATCAGTAGGGATGAAGAGGTCGAAATCAAACAAAAATGTGGGAAGTTCTAGAGAAGAG
JMFF013G21+ TTATCAGTAGGGATGAAGAGGTCGAAATCAAACAAAAATGTGGGAAGTTCTAGAGAAGAG
JMSF027G10+ TTATCAGTAGGGATGAAGAGGTCGAAATCAAACAAAAATGTGGGAAGTTCTAGAGAAGAG
JMFS093F09+ TTATCAGTAGGGATGAAGAGGTCGAAATCAAACAAAAATGTGGGAAGTTCTAGAGAAGAG
JMSF052P05+ TTATCAGTAGGGATGAAGAGGTCGAAATCAAACAAAAATGTGGGAAGTTCTAGAGAAGAG
JMFS124G03+ TTATCAGTAGGGATGAAGAGGTCGAAATCAAACAAAAATGTGGGAAGTTCTAGAGAAGAG
JMFF037L05+ TTATCAGTAGGGATGAAGAGGTCGAAATCAAACAAAAATGTGGGAAGTTCTAGAGAAGAG
JMFF033F16+ TTATCAGTAGGGATGAAGAGGTNGAAATCAAACAAAAATGTGGGAAGTTCTAGAGAAGAG
JMSF005H19+ TTATCAGTAGGGATGAAGAGGTCGAAATCAAACAAAAATGTGGGAAGTTCTAGAGAAGAG
JMFS001D06+ TTATCAGTAGGGATGAAGAGGTCGAAATCAAACAAAAATGTGGGAAGTTCTAGAGAAGAG
                      ____________________________________________________________
consensus TTATCAGTAGGGATGAAGAGGTCGAAATCAAACAAAAATGTGGGAAGTTCTAGAGAAGAG
 
. : . : . : . : . : . :
JMSF035B13+ AAAAACTGATAAATCACAGC
JMFF019H04+ AAAAACTGATAAATC
JMFF028C02+ AAAAACTGATAAATC
JMFF013G21+ AAAAACTGATAAATC
JMSF027G10+ AAAAACTGATAAATCACAGC
JMFS093F09+ AAAAACTGATAAATCACAGCGAAAGAGAGAAAGAAAGA
JMSF052P05+ AAAAACTGATAAATCACAGC
JMFS124G03+ AAAAACTGATAAATCACAGCGAAAGAGAGAAAGAAAGA
JMFF037L05+ AAAAACTGATAAATCAC
JMFF033F16+ AAAAACTGATAAATCAC
JMSF005H19+ AAAAACTGATAAATCAC
JMFS001D06+ AAAAACTGATAAATCACAGCGAAAGAGAGAAAGAAAGACAGATAGATGGAGCTATATTTT
                      ____________________________________________________________
consensus AAAAACTGATAAATCACAGCGAAAGAGAGAAAGAAAGACAGATAGATGGAGCTATATTTT