Previous Contig 002820:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN025G12Sequence504002820 (3)
JMFN029D02Sequence492002820 (3)
JMFN046K05Sequence453002820 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN029D02+ AAATAAAAAGATGTTTGTATATTTTATTTTTTAATAAAAGCAAATACTTGTGCATGA
JMFN025G12+ AAATAAAAAGATGTTTGTATATTTTATTTTTTAATAAAAGCAAATACTTGTGCATGA
                      ____________________________________________________________
consensus AAATAAAAAGATGTTTGTATATTTTATTTTTTAATAAAAGCAAATACTTGTGCATGA
 
. : . : . : . : . : . :
JMFN029D02+ CAAGTCCATAAATTACAACGAAGTTATAATACAAAATGGAAGAACATTAGTCTCGAAAGG
JMFN025G12+ CAAGTCCATAAATTACAACGAAGTTATAATACAAAATGGAAGAACATTAGTCTCGAAAGG
JMFN046K05+ AATACAAAATGGAAGAACATTAGTCTCGAAAGG
                      ____________________________________________________________
consensus CAAGTCCATAAATTACAACGAAGTTATAATACAAAATGGAAGAACATTAGTCTCGAAAGG
 
. : . : . : . : . : . :
JMFN029D02+ GATGAAGCATAACAAGGCTATAATACAAGGTTGAGAGGCATCAATTCCAATCTTAATTTT
JMFN025G12+ GATGAAGCATAACAAGGCTATAATACAAGGTTGAGAGGCATCAATTCCAATCTTAATTTT
JMFN046K05+ GATGAAGCATAACAAGGCTATAATACAAGGTTGAGAGGCATCAATTCCAATCTTAATTTT
                      ____________________________________________________________
consensus GATGAAGCATAACAAGGCTATAATACAAGGTTGAGAGGCATCAATTCCAATCTTAATTTT
 
. : . : . : . : . : . :
JMFN029D02+ CTTGCTAATACTCTCGTGGTCGAGCTTTAGGCTTCTCTGATTTTATGAAATTTTGGAAAA
JMFN025G12+ CTTGCTAATACTCTCGTGGTCGAGCTTTAGGCTTCTCTGATTTTATGAAATTTTGGAAAA
JMFN046K05+ CTTGCTAATACTCTCGTGGTCGAGCTTTAGGCTTCTCTGATTTTATGAAATTTTGGAAAA
                      ____________________________________________________________
consensus CTTGCTAATACTCTCGTGGTCGAGCTTTAGGCTTCTCTGATTTTATGAAATTTTGGAAAA
 
. : . : . : . : . : . :
JMFN029D02+ TAAAACCAAGAAAAGGTATACTAAATCAAAAGTAGAGGATAAAGGAAGAAGAATGTTGAG
JMFN025G12+ TAAAACCAAGAAAAGGTATACTAAATCAAAAGTAGAGGATAAAGGAAGAAGAATGTTGAG
JMFN046K05+ TAAAACCAAGAAAAGGTATACTAAATCAAAAGTAGAGGATAAAGGAAGAAGAATGTTGAG
                      ____________________________________________________________
consensus TAAAACCAAGAAAAGGTATACTAAATCAAAAGTAGAGGATAAAGGAAGAAGAATGTTGAG
 
. : . : . : . : . : . :
JMFN029D02+ AAGAGGATGAAGAATAGCGAGGTGTTGATGAGAGGAAAGAAGGACGCCTGGTGGGGACAA
JMFN025G12+ AAGAGGATGAAGAATAGCGAGGTGTTGATGAGAGGAAAGAAGGACGCCTGGTGGGGACAA
JMFN046K05+ AAGAGGATGAAGAATAGCGAGGTGTTGATGAGAGGAAAGAAGGACGCCTGGTGGGGACAA
                      ____________________________________________________________
consensus AAGAGGATGAAGAATAGCGAGGTGTTGATGAGAGGAAAGAAGGACGCCTGGTGGGGACAA
 
. : . : . : . : . : . :
JMFN029D02+ TAATAAGTAGAATTTGGTCTGTCATCCTCCCCATCACCATTCCCCACTCTGCAACTAACT
JMFN025G12+ TAATAAGTAGAATTTGGTCTGTCATCCTCCCAATCACCATTCCCCACTCTGCAACTAACT
JMFN046K05+ TAATAAGTAGAATTTGGTCTGTCATCCTCCCCATCACCATTCCCCACTCTGCAACTAACT
                      ____________________________________________________________
consensus TAATAAGTAGAATTTGGTCTGTCATCCTCCCCATCACCATTCCCCACTCTGCAACTAACT
 
. : . : . : . : . : . :
JMFN029D02+ CCACCATCTTCCCCACTTTCATCATCTTTCTTTTCCGGTAAGATTCCGGCGGCCGGCGGC
JMFN025G12+ CCACCATCTTCCCCACTTTCATCATCTTTCTTTTCCGGTAAGATTCCGGCGGCCGGCGGC
JMFN046K05+ CCACCATCTTCCCCACTTTCATCATCTTTCTTTTCCGGTAAGATTCCGGCGGCCGGCGGC
                      ____________________________________________________________
consensus CCACCATCTTCCCCACTTTCATCATCTTTCTTTTCCGGTAAGATTCCGGCGGCCGGCGGC
 
. : . : . : . : . : . :
JMFN029D02+ CTCTCCGCTAATCAC
JMFN025G12+ CTCTCCGCTAATCACGTCACAAATGGC
JMFN046K05+ CTCTCCGCTAATCACGTCACAAATGGCTGAGAAAGCTCAATACTATAGAGATGGAGTACA
                      ____________________________________________________________
consensus CTCTCCGCTAATCACGTCACAAATGGCTGAGAAAGCTCAATACTATAGAGATGGAGTACA