Previous Contig 002815:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN018J10Sequence435002815 (3)gb:AY144442_15835351e-24Sorghum bicolor BAC 95A23/98N8.1 Rph region, partial sequence.
JMFN046E13Sequence582002815 (3)gb:AY144442_15835352e-34Sorghum bicolor BAC 95A23/98N8.1 Rph region, partial sequence.
JMFS066H12Sequence602002815 (3)gb:AY144442_15835353e-36Sorghum bicolor BAC 95A23/98N8.1 Rph region, partial sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS066H12+ TCCTTCC
                      ____________________________________________________________
consensus TCCTTCC
 
. : . : . : . : . : . :
JMFS066H12+ GCTTGATCTCCGCCACGCGCCGCCGCACGTCGTCGTACATGACGCAGCTCCGGTTGGCAT
JMFN046E13+ GCCGCCGCACGTTGTCGTACATGACGCAGCTCCGGTGNGCAT
                      ____________________________________________________________
consensus GCTTGATCTCCGCCACGCGCCGCCGCACGTTGTCGTACATGACGCAGCTCCGGTTGGCAT
 
. : . : . : . : . : . :
JMFS066H12+ AGGACCCTTCGATCTCGAAAACCCTGGCATTCTTCGATCCTTTCGCTCCGGAGCCACGGA
JMFN046E13+ AGGACCCTTCGATCTCGAAAACCCTGGCATTCTTCGATCCTTTCGCTCCGGAGCCACGGA
                      ____________________________________________________________
consensus AGGACCCTTCGATCTCGAAAACCCTGGCATTCTTCGATCCTTTCGCTCCGGAGCCACGGA
 
. : . : . : . : . : . :
JMFS066H12+ GCGAGGTCACGTGCGCTAGGGACTTCGAATTCAGGAGGCTCACGTGCTTCCTAACCGAAT
JMFN018J10+ TCACGTGCTTCCTAACCGAAT
JMFN046E13+ GCGAGGTCACGTGCGCTAGGGACTTCGAATTCAGGAGGCTCACGTGCTTCCTAACCGAAT
                      ____________________________________________________________
consensus GCGAGGTCACGTGCGCTAGGGACTTCGAATTCAGGAGGCTCACGTGCTTCCTAACCGAAT
 
. : . : . : . : . : . :
JMFS066H12+ ACAGCGGACGATCCGCCGTCTCTCCGTCGTACACCACCCAGTTGTCCGCCAAGCTTAGCC
JMFN018J10+ ACAGCGGACGATCCGCCGTCTCTCCGTCATACACCACCCAGTTGTCCGCCAAGCTTAGCC
JMFN046E13+ ACAGCGGACGATCCGCCGTCTCTCCGTCGTACACCACCCAGTTGTCCGCCAAGCTTAGCC
                      ____________________________________________________________
consensus ACAGCGGACGATCCGCCGTCTCTCCGTCGTACACCACCCAGTTGTCCGCCAAGCTTAGCC
 
. : . : . : . : . : . :
JMFS066H12+ TCTTGCGGCGAATAGTGAAGAGCGAGTTGCCGGAGGCGTCCATGAGAACGATTTCTGCTC
JMFN018J10+ TCTTGCGGCGAATAGTGAAGAGCGAGTTGCCGGAGGCGTCCATGAGAACGATTTCTGCTC
JMFN046E13+ TCTTGCGGCGAATAGTGAAGAGCGAGTTGCCGGAGGCGTCCATGAGAACGATTTCTGCTC
                      ____________________________________________________________
consensus TCTTGCGGCGAATAGTGAAGAGCGAGTTGCCGGAGGCGTCCATGAGAACGATTTCTGCTC
 
. : . : . : . : . : . :
JMFS066H12+ GATTGCTGGAGTCATAGTAGTTATCGACGCGGTAGACGAGGTTCCCCTTATCGTCGAACA
JMFN018J10+ GA-TGCTGGAGTCATAGTAGTTATCGACGCGGTAGACGAGGTTCCCCTTATCGTCGAACA
JMFN046E13+ GATTGCTGGAGTCATAGTAGTTATCGACGCGGTAGACGAGGTTCCCCTTATCGTCGAACA
                      ____________________________________________________________
consensus GATTGCTGGAGTCATAGTAGTTATCGACGCGGTAGACGAGGTTCCCCTTATCGTCGAACA
 
. : . : . : . : . : . :
JMFS066H12+ CCGTAAAGCCGTCGCAGTTGAAAAGCAGCGACTTCTTCCACACGGTGAGCACTGTAGGCT
JMFN018J10+ CCGTAAAGCCGTCGCAGTTGAAAAGCAGCGACTTCTTCCACACGGTGAGCACTGTAGGCT
JMFN046E13+ CCGTAAAGCCGTCGCAGTTGAAAAGCAGCGACTTCTTCCACACGGTGAGCACTGTAGGCT
                      ____________________________________________________________
consensus CCGTAAAGCCGTCGCAGTTGAAAAGCAGCGACTTCTTCCACACGGTGAGCACTGTAGGCT
 
. : . : . : . : . : . :
JMFS066H12+ GCGGCGGCGATGAGAGGCAGTGGCAGGCCGGCCTGGGAAGCTCCTCATCAGCCAGAGCAG
JMFN018J10+ GCGGCGGCGATGAGAGGCAGTGGCAGGCCGGCCTGGGAAGCTCCTCATCAGCCAGAGCAG
JMFN046E13+ GCGGCGGCGATGAGAGGCAGTGGCAGGCCGGCCTGGGAAGCTCCTCATCAGCCAGAGCAG
                      ____________________________________________________________
consensus GCGGCGGCGATGAGAGGCAGTGGCAGGCCGGCCTGGGAAGCTCCTCATCAGCCAGAGCAG
 
. : . : . : . : . : . :
JMFS066H12+ TAGGAATGGCGGAGGCCGCGTTTGGGTGTACCTTTGTCATCAATTATCAGAAGTGACGTT
JMFN018J10+ TAGGAATGGCGGAGGCCGCGTTTGGGTGTACCTTTGTCATCAATTATCAGAAGTGACGTT
JMFN046E13+ TAGGAATGGCGGAGGCCGCGTTTGGGTGTACCTTTGTCATCAATTATCAGAAGTGACGTT
                      ____________________________________________________________
consensus TAGGAATGGCGGAGGCCGCGTTTGGGTGTACCTTTGTCATCAATTATCAGAAGTGACGTT
 
. : . : . : . : . : . :
JMFS066H12+ CTGACTGGGAAGAATGTAGAGAGATGTAGGTGGTTGCAGAGGGAAGAGAGAGAGA
JMFN018J10+ CTGACTGGGAAGAATGTAGAGAGATGTAGGTGGTTGCAGAGGGAAGAGAGAGAGA
JMFN046E13+ CTGACTGGGAAGAATGTAGAGAGATGTAGGTGGTTGCAGAGGGAAGAGAGAGAGACGATG
                      ____________________________________________________________
consensus CTGACTGGGAAGAATGTAGAGAGATGTAGGTGGTTGCAGAGGGAAGAGAGAGAGACGATG