Previous Contig 002811:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN029P16Sequence523002811 (2)gb:AP005063_18474063e-37Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN
JMFN046B09Sequence643002811 (2)gb:AB007645_15101486e-41Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K8K14.>gb:AY057698_156

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN029P16+ TTTTTGCCATAACAAAAACCATTAAATCAATAGTTCAAACTACACAAAGTCTAAT
                      ____________________________________________________________
consensus TTTTTGCCATAACAAAAACCATTAAATCAATAGTTCAAACTACACAAAGTCTAAT
 
. : . : . : . : . : . :
JMFN029P16+ CGAATCAAAGGAGGTGAAGATTACAGTTGCAGAACTATCCACCTAAGTTGTAGTAAAGCT
                      ____________________________________________________________
consensus CGAATCAAAGGAGGTGAAGATTACAGTTGCAGAACTATCCACCTAAGTTGTAGTAAAGCT
 
. : . : . : . : . : . :
JMFN029P16+ AATATCACCAATGTTTTGAATCACTCACTCGAATTTCTACACCGAGATTCTATATGCAAC
                      ____________________________________________________________
consensus AATATCACCAATGTTTTGAATCACTCACTCGAATTTCTACACCGAGATTCTATATGCAAC
 
. : . : . : . : . : . :
JMFN029P16+ ACTGCAGCTACATTTCGACAAAGTTCAAGCGTCCCGAATCGCTATCCCATGCCTAGTATA
JMFN046B09+ ACAAAGTTCAAGCGTCCCGAATCGCTATCCCATGCCTAGTATA
                      ____________________________________________________________
consensus ACTGCAGCTACATTTCGACAAAGTTCAAGCGTCCCGAATCGCTATCCCATGCCTAGTATA
 
. : . : . : . : . : . :
JMFN029P16+ GGTTCTAAATTTTCTACATACGGAAGTCCAAGACACAAACCACGTTGTTTGAGAAACAAG
JMFN046B09+ GGTTCTACATTTTCTACATACGGAAGTCCAAGACACAAACCACGTTGTNTGAGAAACAAG
                      ____________________________________________________________
consensus GGTTCTACATTTTCTACATACGGAAGTCCAAGACACAAACCACGTTGTTTGAGAAACAAG
 
. : . : . : . : . : . :
JMFN029P16+ CAGCAACCTTCTTGCCTTCCTTGTCCCAACAAACTTCGAAAATCCCACCATTCCCGCTGT
JMFN046B09+ CAGCAACCTTCTTGCCTTCCTTGTCCCAACAAACTTCGAAAATCCCACCATTCCCGCTGT
                      ____________________________________________________________
consensus CAGCAACCTTCTTGCCTTCCTTGTCCCAACAAACTTCGAAAATCCCACCATTCCCGCTGT
 
. : . : . : . : . : . :
JMFN029P16+ AGGTCTTCACAATCTTGGCTTCCTTCACCGACCATATGATCAGGCATTTGTCTAACGATC
JMFN046B09+ AGGTCTTCACAATCTTGGCTTCCTTCACCGACCATATGATCAGGCATTTGTCTAACGATC
                      ____________________________________________________________
consensus AGGTCTTCACAATCTTGGCTTCCTTCACCGACCATATGATCAGGCATTTGTCTAACGATC
 
. : . : . : . : . : . :
JMFN029P16+ CACTGGCTAAGTACTCACCGTCTGGGCTAAATGCAACAGAATAAACAGGATCCCTGTGGC
JMFN046B09+ CACTGGCTAAGTACTCACCGTCTGGGCTAAATGCAACAGAATAAACAGGATCCCTGTGGC
                      ____________________________________________________________
consensus CACTGGCTAAGTACTCACCGTCTGGGCTAAATGCAACAGAATAAACAGGATCCCTGTGGC
 
. : . : . : . : . : . :
JMFN029P16+ CATTCAAGCTGTGGATAACTCGCCCTACTTCAACATCCCATAGCTTAA
JMFN046B09+ CATTCAAGCTGTGGATAACTCGCCCTACTTCAACATCCCATAGCTTAATGGTTGAGTCAA
                      ____________________________________________________________
consensus CATTCAAGCTGTGGATAACTCGCCCTACTTCAACATCCCATAGCTTAATGGTTGAGTCAA
 
. : . : . : . : . : . :
JMFN046B09+ AGGAGGCACTATACAAGAAATCACAGAGTTTAAACAGTATAAAACATTGGACGATTATTT
                      ____________________________________________________________
consensus AGGAGGCACTATACAAGAAATCACAGAGTTTAAACAGTATAAAACATTGGACGATTATTT
 
. : . : . : . : . : . :
JMFN046B09+ TTCAAGATAAAAGAAGTCGCTAAGTAATTCAAAGAAAATAACAAATGTAAGTATTCACGG
                      ____________________________________________________________
consensus TTCAAGATAAAAGAAGTCGCTAAGTAATTCAAAGAAAATAACAAATGTAAGTATTCACGG
 
. : . : . : . : . : . :
JMFN046B09+ TTCTATGGACACTAGAATAGTAGCATCAGAGTACTAGAAAGCTAAGTGATCTTCTATAGA
                      ____________________________________________________________
consensus TTCTATGGACACTAGAATAGTAGCATCAGAGTACTAGAAAGCTAAGTGATCTTCTATAGA
 
. : . : . : . : . : . :
JMFN046B09+ TCACGGAGAGGGGTACTCTTCCAAAACAAAAGGTATAGATCATTATTACAACTGTTGTGA
                      ____________________________________________________________
consensus TCACGGAGAGGGGTACTCTTCCAAAACAAAAGGTATAGATCATTATTACAACTGTTGTGA
 
. : . : . : . : . : . :
JMFN046B09+ TGGAATTAGTATCAACAAAATGATAATAGTTACCTCTCTACTTCTCTTAGAGAGATAACA
                      ____________________________________________________________
consensus TGGAATTAGTATCAACAAAATGATAATAGTTACCTCTCTACTTCTCTTAGAGAGATAACA