Previous Contig 002794:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN033I16Sequence642002794 (5)pir|T12992|T129926e-57ribosomal protein S20, cytosolic - Arabidopsis thaliana>gb:ATT21L8_1555157 Arabi
JMFN044F04Sequence624002794 (5)pir|T12992|T129926e-57ribosomal protein S20, cytosolic - Arabidopsis thaliana>gb:ATT21L8_1555157 Arabi
JMSF025O19Sequence128002794 (5)pir|T12992|T129924e-06ribosomal protein S20, cytosolic - Arabidopsis thaliana>gb:ATT21L8_1555157 Arabi
JMSF049C09Sequence603002794 (5)pir|T12992|T129925e-57ribosomal protein S20, cytosolic - Arabidopsis thaliana>gb:ATT21L8_1555157 Arabi556002794 (5)pir|T12992|T129925e-57ribosomal protein S20, cytosolic - Arabidopsis thaliana>gb:ATT21L8_1555157 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN033I16+ TGCGGGAAAATTACACCACATGAATTCGCAAAATTCTCGTTGT
JMFN044F04+ ATGAATTCGCAAAATTCTCGTTGT
                      ____________________________________________________________
consensus TGCGGGAAAATTACACCACATGAATTCGCAAAATTCTCGTTGT
 
. : . : . : . : . : . :
rJMSF049C09- G
JMFN033I16+ CACATCATGTCTTTCTTAACTTGGAAAATATAATACCAAAACTCATAATAGAGTACACAG
JMFN044F04+ CACATCATGTCTTTCTTAACTNGGAAAATATAATACCAAAACTCATAATAGAGTACACAG
                      ____________________________________________________________
consensus CACATCATGTCTTTCTTAACTTGGAAAATATAATACCAAAACTCATAATAGAGTACACAG
 
. : . : . : . : . : . :
rJMSF049C09- TCTACAATATTTAAGGGCACAGTTTGGAGGCTGGAAAGAAAAAATCCAAAACAGCCATCA
JMFN033I16+ TCTACAATATTTAAGGGCACAGTTTGGAGGCTGGAAAGAAAAAATCCAAAACAGCCATCA
JMFN044F04+ TCTACAATATTTAAGGGCACAGTTTGGAGGCTGGAAAGAAAAAATCCAAAACAGCCATCA
                      ____________________________________________________________
consensus TCTACAATATTTAAGGGCACAGTTTGGAGGCTGGAAAGAAAAAATCCAAAACAGCCATCA
 
. : . : . : . : . : . :
rJMSF049C09- CTGGAAGCACAAACCAAAATTAAAACTAAGCGATGTTGCTGAAGTTTTAAGAATCAGCAA
JMSF049C09+ AAGAATCAGCAA
JMFN033I16+ CTGGAAGCACAAACCAAAATTAAAACTAAGCGATGTTGCTGAAGTTTTAAGAATCAGCAA
JMFN044F04+ CTGGAAGCACAAACCAAAATTAAAACTAAGCGATGTTGCTGAAGTTTTAAGAATCAGCAA
                      ____________________________________________________________
consensus CTGGAAGCACAAACCAAAATTAAAACTAAGCGATGTTGCTGAAGTTTTAAGAATCAGCAA
 
. : . : . : . : . : . :
rJMSF049C09- TTGTAACCTCGACCTCTACCCCAGGTTCAATGGTGATAGATGTGATCTGCTTTACAACTT
JMSF049C09+ TTGTAACCTCGACCTCTACCCCAGGTTCAATGGTGATAGATGTGATCTGCTTTACAACTT
JMFN033I16+ TTGTAACCTCGACCTCTACCCCAGGTTCAATGGTGATAGATGTGATCTGCTTTACAACTT
JMFN044F04+ TTGTAACCTCGACCTCTACCCCAGGTTCAATGGTGATAGATGTGATCTGCTTTACAACTT
                      ____________________________________________________________
consensus TTGTAACCTCGACCTCTACCCCAGGTTCAATGGTGATAGATGTGATCTGCTTTACAACTT
 
. : . : . : . : . : . :
rJMSF049C09- CTGGGGAACTGAACAGGTCAATCACTCGCTTGTGAACACGGAGCTCAAATCTATCCCATG
JMSF049C09+ CTGGGGAACTGAACAGGTCAATCACTCGCTTGTGAACACGGAGCTCAAATCTATCCCATG
JMFN033I16+ CTGGGGAACTGAACAGGTCAATCACTCGCTTGTGAACACGGAGCTCAAATCTATCCCATG
JMFN044F04+ CTGGGGAACTGAACAGGTCAATCACTCGCTTGTGAACACGGAGCTCAAATCTATCCCATG
                      ____________________________________________________________
consensus CTGGGGAACTGAACAGGTCAATCACTCGCTTGTGAACACGGAGCTCAAATCTATCCCATG
 
. : . : . : . : . : . :
rJMSF049C09- TGTTGGTACCTTCTCCACAGGGAGACTTTCTAGTGGTGATGTGAAGAACCTTGGTTGGCA
JMSF049C09+ TGTTGGTACCTTCTCCACAGGGAGACTTTCTAGTGGTGATGTGAAGAACCTTGGTTGGCA
JMFN033I16+ TGTTGGTACCTTCTCCACAGGGAGACTTTCTAGTGGTGATGTGAAGAACCTTGGTTGGCA
JMFN044F04+ TGTTGGTACCTTCTCCACAGGGAGACTTTCTAGTGGTGATGTGAAGAACCTTGGTTGGCA
                      ____________________________________________________________
consensus TGTTGGTACCTTCTCCACAGGGAGACTTTCTAGTGGTGATGTGAAGAACCTTGGTTGGCA
 
. : . : . : . : . : . :
rJMSF049C09- TCCTCACTGGTCCCTTAACCCGGAGTCTTTTATCCTTGGCACCACGTACCAAATCAGCAC
JMSF049C09+ TCCTCACTGGTCCCTTAACCCGGAGTCTTTTATCCTTGGCACCACGTACCAAATCAGCAC
JMFN033I16+ TCCTCACTGGTCCCTTAACCCGGAGTCTTTTATCCTTGGCACCACGTACCAAATCAGCAC
JMFN044F04+ TCCTCACTGGTCCCTTAACCCGGAGTCTTTTATCCTTGGCACCACGTACCAAATCAGCAC
                      ____________________________________________________________
consensus TCCTCACTGGTCCCTTAACCCGGAGTCTTTTATCCTTGGCACCACGTACCAAATCAGCAC
 
. : . : . : . : . : . :
rJMSF049C09- AAACTTTCTCGAGGTTTTTGACGTTTTTCGATGACAGAGTGATTCTGATCTTGTGCACCT
JMSF049C09+ AAACTTTCTCGAGGTTTTTGACGTTTTTCGATGACAGAGTGATTCTGATCTTGTGCACCT
rJMSF025O19- CTTTCTCGAGGTTTTTGACGTTTTTCNATGACAGAGTGATTCNGATCTTGTGCACCT
JMFN033I16+ AAACTTTCTCGAGGTTTTTGACGTTTTTCGATGACAGAGTGATTCTGATCTTGTGCACCT
JMFN044F04+ AAACTTTCTCGAGGTTTTTGACGTTTTTCGATGACAGAGTGATTCTGATCTTGTGCACCT
                      ____________________________________________________________
consensus AAACTTTCTCGAGGTTTTTGACGTTTTTCGATGACAGAGTGATTCTGATCTTGTGCACCT
 
. : . : . : . : . : . :
rJMSF049C09- GTTCCTGTGGCTCCTCTAGCCCGGGCTTTGTCGACTTCACCGCTTG
JMSF049C09+ GTTCCTGTGGCTCCTCTAGCCCGGGCTTTGTCGACTTCACCGCTTG
rJMSF025O19- GTTCCTGTGGCTCCTCTAGCCCGGGGTTTGTCGACTTCACCGCTTGNTANGCCATAACTT
JMFN033I16+ GTTCCTGTGGCTCCTCTAGCCCGGGCTTTGTCGACTTCACCGCTTGGTATGCCATAACTT
JMFN044F04+ GTTCCTGTGGCTCCTCTAGCCCGGGCTTTGTCGACTTCACCGCTTGGTATGCCATAACTT
                      ____________________________________________________________
consensus GTTCCTGTGGCTCCTCTAGCCCGGGCTTTGTCGACTTCACCGCTTGGTATGCCATAACTT
 
. : . : . : . : . : . :
rJMSF025O19- GGATTTGCTTT
JMFN033I16+ GGATTTGCTTTCTGCGGCGAGAAGTGGAGTACTCCGGCTGATGCAGAGATGAACTTCAG
JMFN044F04+ GGATTTGCTTTCTGCGGCGAGAAGTGGAGTACTCCGGCTGATGCAGAGATGAACTTCAGA
                      ____________________________________________________________
consensus GGATTTGCTTTCTGCGGCGAGAAGTGGAGTACTCCGGCTGATGCAGAGATGAACTTCAGA