Previous Contig 002790:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN044D01Sequence503002790 (7)pir|T05165|T051651e-33hypothetical protein F18E5.190 - Arabidopsis thaliana>gb:ATCHRIV55_1545994 Arabi
JMSF015B10Sequence254002790 (7)gb:AP005127_18482544e-16Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN771002790 (7)pir|T05165|T05165e-100hypothetical protein F18E5.190 - Arabidopsis thaliana>gb:ATCHRIV55_1545994 Arabi
JMSF023I09Sequence653002790 (7)pir|T05165|T051652e-83hypothetical protein F18E5.190 - Arabidopsis thaliana>gb:ATCHRIV55_1545994 Arabi755002790 (7)pir|T05165|T051657e-94hypothetical protein F18E5.190 - Arabidopsis thaliana>gb:ATCHRIV55_1545994 Arabi
JMSF052D24Sequence644002790 (7)pir|T05165|T051652e-82hypothetical protein F18E5.190 - Arabidopsis thaliana>gb:ATCHRIV55_1545994 Arabi902002790 (7)pir|T05165|T05165e-119hypothetical protein F18E5.190 - Arabidopsis thaliana>gb:ATCHRIV55_1545994 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF015B10- G
                      ____________________________________________________________
consensus G
 
. : . : . : . : . : . :
JMSF015B10- GTCTCGATCATAGCTACCAACCCCCCTTCCTTCATTCCTTCATACAGAAAAACCGAAGAG
JMSF052D24- TCGATCATAGCTACCAACCCCCCTTCCTTCATTCCTTCA-----AAAAACCGAAGAG
JMSF023I09- TCGATCATAGCTACCAACCCCCCTTCCTTCATTCCTTCATACAGAAAAACCGAAGAG
                      ____________________________________________________________
consensus GTCTCGATCATAGCTACCAACCCCCCTTCCTTCATTCCTTCATACAGAAAAACCGAAGAG
 
. : . : . : . : . : . :
JMSF015B10- AATGGCGGGTGTGAACCTGACAATGACGGCTTGCACTGTGTGCCTGATGCTAACCTTGCA
JMSF052D24- AATGGCGGGTGTGAACCTGACAATGACGGCTTGCACTGTGTGCCTGATGCTAACCTTGCA
JMSF023I09- AATGGCGGGTGTGAACCTGACAATGACGGCTTGCACTGTGTGCCTGATGCTAACCTTGCA
rJMSF052D24+ TGTGTGCCTGATGCTANCCNTGCA
                      ____________________________________________________________
consensus AATGGCGGGTGTGAACCTGACAATGACGGCTTGCACTGTGTGCCTGATGCTAACCTTGCA
 
. : . : . : . : . : . :
JMSF015B10- TTTCACGATACGCCTTGTATCACAACATCTTTCAGCATGGAAGAAACCAAAGGAGCAAAA
JMSF052D24- TTTCACGATACGCCTTGTATCACAACATCTTTCAGCATGGAAGAAACCAAAGGAGCAAAA
JMSF023I09- TTTCACGATACGCCTTGTATCACAACATCTTTCAGCATGGAAGAAACCAAAGGAGCAAAA
rJMSF052D24+ TTNCACGATACGCCTTGTATCACAACATCTTTCAGCATGGAAGAAACCAANGGAGCAAAA
                      ____________________________________________________________
consensus TTTCACGATACGCCTTGTATCACAACATCTTTCAGCATGGAAGAAACCAAAGGAGCAAAA
 
. : . : . : . : . : . :
JMSF015B10- AGCAATACTTATCATCATATTTATGGCTCCCTTGTATGCTGTTGNTTCCTATGTTGGTTT
JMSF052D24- AGCAATACTTATCATCATATTTATGGCTCCCTTGTATGCTGTTGTTTCCTATGTTGGTTT
JMSF023I09- AGCAATACTTATCATCATATTTATGGCTCCCTTGTATGCTGTTGTTTCCTATGTTGGTTT
rJMSF052D24+ AGCAATACTTATCATCATATTTATGGCTCCCTTGTATGCTGTTGTTTCCTATGTTGGTTT
                      ____________________________________________________________
consensus AGCAATACTTATCATCATATTTATGGCTCCCTTGTATGCTGTTGTTTCCTATGTTGGTTT
 
. : . : . : . : . : . :
JMSF015B10- AGTGGATTTTCTC
JMSF052D24- AGTGGATTTTCTCGGGAGCAACACTTTTTTCACATTTCTGGAGTCTGTCAAAGAATGTTA
JMSF023I09- AGTGGATTTTCTCGGGAGCAACACTTTTTTCACATTTCTGGAGTCTGTCAAAGAATGTTA
rJMSF052D24+ AGTGGATTTTCTCGGGAGCAACACTTTTTTCACATTTCTGGAGTCTGTCAAAGAATGTTA
rJMSF015B10+ GGGAGCAACACTTTTTTCACATTTCTGGAGTCTGTCAAAGAATGTTA
rJMSF023I09+ AAGAATGTTA
                      ____________________________________________________________
consensus AGTGGATTTTCTCGGGAGCAACACTTTTTTCACATTTCTGGAGTCTGTCAAAGAATGTTA
 
. : . : . : . : . : . :
JMSF052D24- TGAAGCTCTTGTTATGGCTAAGTTTTTAGGCTTGATGTACACATACCTAAATATATCCTT
JMSF023I09- TGAAGCTCTTGTTATGGCTAAGTTTTTAGGCTTGATGTACACATACCTAAATATATCCTT
rJMSF052D24+ TGAAGCTCTTGTTATGGCTAAGTTTTTAGGCTTGATGTACACATACCTAAATATATCCTT
rJMSF015B10+ TGAAGCTCTTGTTATGGCTAAGTTTTTAGGCTTGATGTACACATACCTAAATATATCCTT
rJMSF023I09+ TGAAGCTCTTGTTATGGCTAAGTTTTTAGGCTTGATGTACACATACCTAAATATATCCTT
                      ____________________________________________________________
consensus TGAAGCTCTTGTTATGGCTAAGTTTTTAGGCTTGATGTACACATACCTAAATATATCCTT
 
. : . : . : . : . : . :
JMSF052D24- AAGCAAAAACATAGTACCAGATGAGATTAAAGGAAGAGAGATTCACCACTCGTTTCCGAT
JMSF023I09- AAGCAAAAACATAGTACCAGATGAGATTAAAGGAAGAGAGATTCACCACTCGTTTCCGAT
rJMSF052D24+ AAGCAAAAACATAGTACCAGATGAGATTAAAGGAAGAGAGATTCACCACTCGTTTCCGAT
rJMSF015B10+ AAGCAAAAACATAGTACCAGATGAGATTAAAGGAAGAGAGATTCACCACTCGTTTCCGAT
rJMSF023I09+ AAGCAAAAACATAGTACCAGATGAGATTAAAGGAAGAGAGATTCACCACTCGTTTCCGAT
                      ____________________________________________________________
consensus AAGCAAAAACATAGTACCAGATGAGATTAAAGGAAGAGAGATTCACCACTCGTTTCCGAT
 
. : . : . : . : . : . :
JMSF052D24- GACTCTCTTTCAGCCTCACACTGCCCGTTTAAACCACCACACATTGAAGCTTCTCAAGGA
JMSF023I09- GACTCTCTTTCAGCCTCACACTGCCCGTTTAAACCACCACACATTGAAGCTTCTCAAGGA
rJMSF052D24+ GACTCTCTTTCAGCCTCACACTGCCCGTTTAAACCACCACACATTGAAGCTTCTCAAGGA
rJMSF015B10+ GACTCTCTTTCAGCCTCACACTGCCCGTTTAAACCACCACACATTGAAGCTTCTCAAGGA
rJMSF023I09+ GACTCTCTTTCAGCCTCACACTGCCCGTTTAAACCACCACACATTGAAGCTTCTCAAGGA
                      ____________________________________________________________
consensus GACTCTCTTTCAGCCTCACACTGCCCGTTTAAACCACCACACATTGAAGCTTCTCAAGGA
 
. : . : . : . : . : . :
JMSF052D24- CTGGACATGGCAATTTGTTTTGATCCGCCCTGTATGCTCTGTGTTAATGATAGCTCTACA
JMSF023I09- CTGGACATGGCAATTTGTTTTGATCCGCCCTGTATGCTCTGTGTTAATGATAGCTCTACA
rJMSF052D24+ CTGGACATGGCAATTTGTTTTGATCCGCCCTGTATGCTCTGTGTTAATGATAGCTCTACA
rJMSF015B10+ CTGGACATGGCAATTTGTTTTGATCCGCCCTGTATGCTCTGTGTTAATGATAGCTCTACA
rJMSF023I09+ CTGGACATGGCAATTTGTTTTGATCCGCCCTGTATGCTCTGTGTTAATGATAGCTCTACA
                      ____________________________________________________________
consensus CTGGACATGGCAATTTGTTTTGATCCGCCCTGTATGCTCTGTGTTAATGATAGCTCTACA
 
. : . : . : . : . : . :
JMSF052D24- ACTTCTTGGAATGTATCCCACTTGGGTTAGCTGGACATTCACCATTATCCTAAACATTTC
JMSF023I09- ACTTCTTGGAATGTATCCCACTTGGGTTAGCTGGACATTCACCATTATCCTAAACATTTC
rJMSF052D24+ ACTTCTTGGAATGTATCCCACTTGGGTTAGCTGGACATTCACCATTATCCTAAACATTTC
rJMSF015B10+ ACTTCTTGGAATGTATCCCACTTGGGTTAGCTGGACATTCACCATTATCCTAAACATTTC
rJMSF023I09+ ACTTCTTGGAATGTATCCCACTTGGGTTAGCTGGACATTCACCATTATCCTAAACATTTC
                      ____________________________________________________________
consensus ACTTCTTGGAATGTATCCCACTTGGGTTAGCTGGACATTCACCATTATCCTAAACATTTC
 
. : . : . : . : . : . :
JMSF052D24- GGTTTCGCTAGCTTTATACTCACTTGTAGTATTCTACCATGTGTTTGC
JMSF023I09- GGTTTCGCTAGCTTTATACTCACTTGTAGTATTCTACCATGTGTTTGCAAAA
rJMSF052D24+ GGTTTCGCTAGCTTTATACTCACTTGTAGTATTCTACCATGTGTTTGCAAAAGAGTTGGC
rJMSF015B10+ GGTTTCGCTAGCTTTATACTCACTTGTAGTATTCTACCATGTGTTTGCAAAAGAGTTGGC
rJMSF023I09+ GGTTTCGCTAGCTTTATACTCACTTGTAGTATTCTACCATGTGTTTGCAAAAGAGTTGGC
JMFN044D01+ CATGTGTTTGCAAAAGAGTTGGC
                      ____________________________________________________________
consensus GGTTTCGCTAGCTTTATACTCACTTGTAGTATTCTACCATGTGTTTGCAAAAGAGTTGGC
 
. : . : . : . : . : . :
rJMSF052D24+ ACCACACAAGCCACTTGCCAAGTTTTTGTGTGTGAAAGGAATTGTCTTCTTCTGTTTCTG
rJMSF015B10+ ACCACACAAGCCACTTGCCAAGTTTTTGTGTGTGAAAGGAATTGTCTTCTTCTGTTTCTG
rJMSF023I09+ ACCACACAAGCCACTTGCCAAGTTTTTGTGTGTGAAAGGAATTGTCTTCTTCTGTTTCTG
JMFN044D01+ ACCACACAAGCCACTTGCCAAGTTTTTGTGTGTGAAAGGAATTGTCTTCTTCTGTTTCTG
                      ____________________________________________________________
consensus ACCACACAAGCCACTTGCCAAGTTTTTGTGTGTGAAAGGAATTGTCTTCTTCTGTTTCTG
 
. : . : . : . : . : . :
rJMSF052D24+ GCAGGGAATTGCGCTCGAGATTCTTGTTGCCCTCGGGATAATAAAATCCCATCATGTCTG
rJMSF015B10+ GCAGGGAATTGCGCTCGAGATTCTTGTTGCCCTCGGGATAATAAAATCCCATCATGTCTG
rJMSF023I09+ GCAGGGAATTGCGCTCGAGATTCTTGTTGCCCTCGGGATAATAAAATCCCATCATGTCTG
JMFN044D01+ GCAGGGAATTGCGCTCGAGATTCTTGTTGCCCTCGGGATAATAAAATCCCATCATGTCTG
                      ____________________________________________________________
consensus GCAGGGAATTGCGCTCGAGATTCTTGTTGCCCTCGGGATAATAAAATCCCATCATGTCTG
 
. : . : . : . : . : . :
rJMSF052D24+ GTTCGATGTGGAGCACATTCAAGAAGCTCTTCAGAATATGTTAGTGATGGTGGAGATGGT
rJMSF015B10+ GTTCGATGTGGAGCACATTCAAGAAGCTCTTCAGAATATGTTAGTGATGGTGGAGATGGT
rJMSF023I09+ GTTCGATGTGGAGCACATTCAAGAAGCTCTTCAGAATATGTTAGTGATGGTGGAGATGGT
JMFN044D01+ GTTCGATGTGGAGCACATTCAAGAAGCTCTTCAGAATATGTTAGTGATGGTGGAGATGGT
                      ____________________________________________________________
consensus GTTCGATGTGGAGCACATTCAAGAAGCTCTTCAGAATATGTTAGTGATGGTGGAGATGGT
 
. : . : . : . : . : . :
rJMSF052D24+ CTTCTTCGCCATCGTTCAGCAGCATGCGTACACTGCAGAGCCTTACCGCAAAGAGAACAA
rJMSF015B10+ CTTCTTCGCCATCGTTCAGCAGCATGCGTACACTGCAGAGCCTTACCGCAAAGAGAACAA
rJMSF023I09+ CTTCTTCGCCATCGTTCAGCAGCATGCGTACACTGCAGAGCCTTACCGCAAAGAGAACAA
JMFN044D01+ CTTTTTCGCCATCGTTCAGCAGCATGCGTACACTGCAGAGCCTTACCGCAAAGAGAACAA
                      ____________________________________________________________
consensus CTTCTTCGCCATCGTTCAGCAGCATGCGTACACTGCAGAGCCTTACCGCAAAGAGAACAA
 
. : . : . : . : . : . :
rJMSF052D24+ GAAGGACTAATTCCAAAGTTGGCGTGTATTTGTAATTTGTATTATCATATAAGAGTTGCT
rJMSF015B10+ GAAGGACTAATTCCAAAGTTGGCGTGTATTTGTAATTTGTATTATCATATAAGAGTTGCT
rJMSF023I09+ GAAGGACTAATTCCAAAGTTGGCGTGTATTTGTAATTTGTATTATCATATAAGAGTTGCT
JMFN044D01+ GAAGGACTAATTCCAAAGTTGGCGTGTATTTGTAATTTGTATTATCATATAAGAGTTGCT
                      ____________________________________________________________
consensus GAAGGACTAATTCCAAAGTTGGCGTGTATTTGTAATTTGTATTATCATATAAGAGTTGCT
 
. : . : . : . : . : . :
rJMSF052D24+ TGTCTAGTATTAGCCCCTGCAGATTCTGCTCTGGTTAT
rJMSF015B10+ TGTCTAGTATTAGCCCCTGCAGATTCTGCTCTGGTTATTGTATTAGATAATTTATGATC
rJMSF023I09+ TGTCTAGTATTAGCCCCTGCAGATTCTGCTCTGGTTATTGTATTAGATAATTTATGATCA
JMFN044D01+ TGTCTAGTATTAGCCCCTGCAGATTCTGCTCTGGTTATTGTATTAGATAATTTATGATCA
                      ____________________________________________________________
consensus TGTCTAGTATTAGCCCCTGCAGATTCTGCTCTGGTTATTGTATTAGATAATTTATGATCA
 
. : . : . : . : . : . :
rJMSF023I09+ TGAGTATAGATTTTGAATTC
JMFN044D01+ TGAGTATAGATTTTGAATTCATGTTATGGAATGTGACTTAACGTAGTCTATTTATTTTGT
                      ____________________________________________________________
consensus TGAGTATAGATTTTGAATTCATGTTATGGAATGTGACTTAACGTAGTCTATTTATTTTGT
 
. : . : . : . : . : . :
JMFN044D01+ GGTAGATTATAAATTGGTXXXXXXXXXXXXXXXXXXXXXXXXXXCTCGAGACTAGTTCTC
                      ____________________________________________________________
consensus GGTAGATTATAAATTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGAGACTAGTTCTC