Previous Contig 002787:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF046L21Sequence566002787 (2)gb:AC005171_15323109e-43Arabidopsis thaliana chromosome 2 clone T4E14 map mi310, complete sequence.>gb:A155021768
JMFN044A12Sequence640002787 (2)gb:AC005171_15323101e-43Arabidopsis thaliana chromosome 2 clone T4E14 map mi310, complete sequence.>gb:A

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN044A12+ AATAATTAATGGGCTGAAAGAGXXXXXXXXXXXXXXXXXX
                      ____________________________________________________________
consensus AATAATTAATGGGCTGAAAGAGNNNNNNNNNNNNNNNNNN
 
. : . : . : . : . : . :
JMFF046L21+ TCCATACAGACAATAAATAA-TAAAATGATAGAAGATGCAAACTAAAGGATTTTGAATTC
JMFN044A12+ TCCATACAGACAATAAATAATTAAAATGATAGAAGATGCAAACTAAAGGATTTTGAATTC
                      ____________________________________________________________
consensus TCCATACAGACAATAAATAATTAAAATGATAGAAGATGCAAACTAAAGGATTTTGAATTC
 
. : . : . : . : . : . :
JMFF046L21+ TTAAATTCTAAGTTTTCTGNAAAATTCTTCCAGCAATAATGGCAGCATCCATCACATCTG
JMFN044A12+ TTTAATTCTAAGGTTTCTTGAAAATTCTTCCAGCAATAATGGCAGCATCCATCACATCTG
                      ____________________________________________________________
consensus TTTAATTCTAAGTTTTCTTGAAAATTCTTCCAGCAATAATGGCAGCATCCATCACATCTG
 
. : . : . : . : . : . :
JMFF046L21+ TTATTATATTCACAACCTCATCAACTTTGCAAGTGTTTCCTTTAAACGTCTTGGCCTTAG
JMFN044A12+ TTATTATATTCACAACCTCATCAACTTTGCAAGTGTTTCCTTTAAACGTCTTGGCCTTAG
                      ____________________________________________________________
consensus TTATTATATTCACAACCTCATCAACTTTGCAAGTGTTTCCTTTAAACGTCTTGGCCTTAG
 
. : . : . : . : . : . :
JMFF046L21+ ATTTCTTGAATTTTGTCACACACGCCAAAAAGTTTTTGTTGCAGTGCTGGCTTAAATAGT
JMFN044A12+ ATTTCTTGAATTTTGTCACACACGCCAAAAAGTTTTTGTTGCAGTGCTGGCTTAAATAGT
                      ____________________________________________________________
consensus ATTTCTTGAATTTTGTCACACACGCCAAAAAGTTTTTGTTGCAGTGCTGGCTTAAATAGT
 
. : . : . : . : . : . :
JMFF046L21+ CATTGCCATTGTTTTGAATGCAAACATCATGCTGCATACAGCAAGCATCAAGGCCGTCGC
JMFN044A12+ CATTGCCATTGTTTTGAATGCAAACATCATGCTGCATACAGCAAGCATCAAGGCCGTCGC
                      ____________________________________________________________
consensus CATTGCCATTGTTTTGAATGCAAACATCATGCTGCATACAGCAAGCATCAAGGCCGTCGC
 
. : . : . : . : . : . :
JMFF046L21+ ACGGCTTTTCCCCTGGACATCCGGTGTACAGAATCCCACAGTATTTCCCATATCTTAGGA
JMFN044A12+ ACGGCTTTTCCCCTGGACATCCGGTGTACAGAATCCCACAGTATTTCCCATATCTTAGGA
                      ____________________________________________________________
consensus ACGGCTTTTCCCCTGGACATCCGGTGTACAGAATCCCACAGTATTTCCCATATCTTAGGA
 
. : . : . : . : . : . :
JMFF046L21+ ATGGGGGCACTCCACAGAACTTGGACTCACACCTTCTACTACATTCTTTGGCCAGGGAAA
JMFN044A12+ ATGGGGGCACTCCACAGAACTTGGACTCACACGTTCTACTACATTCTTTGGCCAGGGAAA
                      ____________________________________________________________
consensus ATGGGGGCACTCCACAGAACTTGGACTCACACGTTCTACTACATTCTTTGGCCAGGGAAA
 
. : . : . : . : . : . :
JMFF046L21+ GGCCGGCGCCGGCGTCAACGCCGACGTTAAGGGCACGAGTTGGAATTACATAGGAGTTGA
JMFN044A12+ GGCCGGCGCCGGCGTCAACGCCGACGTTAAGGGCACGAGTTGGAATTACATAGGAGTTGA
                      ____________________________________________________________
consensus GGCCGGCGCCGGCGTCAACGCCGACGTTAAGGGCACGAGTTGGAATTACATAGGAGTTGA
 
. : . : . : . : . : . :
JMFF046L21+ GGGATATGAATGCAAATAAGAAAAGCAGAGCAAACTTGAATGGCAGAAGAGCAGCCATTA
JMFN044A12+ GGGATATGAATGCAAATAAGAAAAGCAGAGCAAACTTGAATGGCAGAAGAGCAGCCATTA
                      ____________________________________________________________
consensus GGGATATGAATGCAAATAAGAAAAGCAGAGCAAACTTGAATGGCAGAAGAGCAGCCATTA
 
. : . : . : . : . : . :
JMFF046L21+ AAGGATCGCAGA
JMFN044A12+ AAGGATCGCAGATTAGGAAGAATGAGAAAGCTAGCGAGCTCAGATTTATTGGGAATTGAA
                      ____________________________________________________________
consensus AAGGATCGCAGATTAGGAAGAATGAGAAAGCTAGCGAGCTCAGATTTATTGGGAATTGAA