Previous Contig 002785:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN043N23Sequence619002785 (2)gb:AF171929_18875904e-05Homo sapiens metallaproteinase-disintegrin (ADAM29) mRNA, complete cds.
JMFN044I20Sequence574002785 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN044I20+ ACTTAAAAAGAGTTATTACTTAAAAAGAGTTAAAAAGGAATAGCGATTACTAAAAAGAA
JMFN043N23+ TAGCGATTACTAAAAAGAA
                      ____________________________________________________________
consensus ACTTAAAAAGAGTTATTACTTAAAAAGAGTTAAAAAGGAATAGCGATTACTAAAAAGAA
 
. : . : . : . : . : . :
JMFN044I20+ ACCAAAAATATAAGAAGGGTGAGAATATTAGCATTCACCAGTACACTACGAAAGGATAGA
JMFN043N23+ ACCAAATATATAAGAAGGGGGAGAATATAGTCATTCACCAGTACACTACGAAAGGATAGA
                      ____________________________________________________________
consensus ACCAAATATATAAGAAGGGTGAGAATATTGTCATTCACCAGTACACTACGAAAGGATAGA
 
. : . : . : . : . : . :
JMFN044I20+ TTTTACATATACCTGCAGCACTTGATTCACCAAAACAGAAAAGAAAAAAGAATTGTATAA
JMFN043N23+ TTTTACATATACCTGCAGCACTGTATTCACCAAAACAGAAAAGAAAAAAGAATTGTATAA
                      ____________________________________________________________
consensus TTTTACATATACCTGCAGCACTTTATTCACCAAAACAGAAAAGAAAAAAGAATTGTATAA
 
. : . : . : . : . : . :
JMFN044I20+ TCTTCAGTCCACGGGATCTTCACAGCGCAGGCAGGCAGGCTAAAACAAAGAAACGCAGAA
JMFN043N23+ TCTTCAGTCCACGGGATCTTCACAGCGCAGGCAGGCAGGCTAAAACAAAGAAACGCAGAA
                      ____________________________________________________________
consensus TCTTCAGTCCACGGGATCTTCACAGCGCAGGCAGGCAGGCTAAAACAAAGAAACGCAGAA
 
. : . : . : . : . : . :
JMFN044I20+ CTCCATGTCACCAGCACGAGCACAAACCAGCGAGCCAAAGAACAAATCATGCTACAAATA
JMFN043N23+ CTCCATGTCACCAGCACGAGCACAAACCAGCGAGCCAAAGAACAAATCATGCTACAAATA
                      ____________________________________________________________
consensus CTCCATGTCACCAGCACGAGCACAAACCAGCGAGCCAAAGAACAAATCATGCTACAAATA
 
. : . : . : . : . : . :
JMFN044I20+ AATAGGTCAATCATCATCAGACAGACAGACCACATCAGCACCAGCATTTGGTTCAGCTGC
JMFN043N23+ AATAGGTCAATCATCATCAGACAGACAGACCACATCAGCACCAGCATTTGGTTCAGCTGC
                      ____________________________________________________________
consensus AATAGGTCAATCATCATCAGACAGACAGACCACATCAGCACCAGCATTTGGTTCAGCTGC
 
. : . : . : . : . : . :
JMFN044I20+ AGAGGTGCCCGCTGCATTGCCTGTTGT
JMFN043N23+ AGAGGTGCCCGCTGCATTGCCCGTTGTCACGACTCTATTGTTGGGTTCTGAGTTCTTATT
                      ____________________________________________________________
consensus AGAGGTGCCCGCTGCATTGCCTGTTGTCACGACTCTATTGTTGGGTTCTGAGTTCTTATT
 
. : . : . : . : . : . :
JMFN043N23+ TACAGTGGTTGGCTGTAGCTGTGGTGGTGCTGGTACCTTCTGATGTGAAAGATTAGAGGA
                      ____________________________________________________________
consensus TACAGTGGTTGGCTGTAGCTGTGGTGGTGCTGGTACCTTCTGATGTGAAAGATTAGAGGA
 
. : . : . : . : . : . :
JMFN043N23+ TACGACTTGTGGCTGCTGAGGTGCAACCCGAGGGAGGGAGGATGAAAGTGTCTGAGACTG
                      ____________________________________________________________
consensus TACGACTTGTGGCTGCTGAGGTGCAACCCGAGGGAGGGAGGATGAAAGTGTCTGAGACTG
 
. : . : . : . : . : . :
JMFN043N23+ AGGTGCAACCCGGGGGAGGGAGGGTGAAGGTGCAACCCTAGGGTGGGAGGATGAAGGTGT
                      ____________________________________________________________
consensus AGGTGCAACCCGGGGGAGGGAGGGTGAAGGTGCAACCCTAGGGTGGGAGGATGAAGGTGT
 
. : . : . : . : . : . :
JMFN043N23+ CTGCGTGCTGAGGTGCAACCCAAGGGCGGGAGGATGAAGGCGCCTGATGTTGAGGTGCAA
                      ____________________________________________________________
consensus CTGCGTGCTGAGGTGCAACCCAAGGGCGGGAGGATGAAGGCGCCTGATGTTGAGGTGCAA