Previous Contig 002782:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004L17Sequence748002782 (4)gb:AY497479_16092513e-69Lycopersicon esculentum xyloglucan endotransglucosylase-hydrolase XTH9 (XTH9) mR
JMFF018B14Sequence685002782 (4)gb:AY497479_16092512e-59Lycopersicon esculentum xyloglucan endotransglucosylase-hydrolase XTH9 (XTH9) mR
JMFN016J16Sequence580002782 (4)gb:AY497479_16092511e-38Lycopersicon esculentum xyloglucan endotransglucosylase-hydrolase XTH9 (XTH9) mR
JMFN043K24Sequence596002782 (4)gb:AY497479_16092518e-66Lycopersicon esculentum xyloglucan endotransglucosylase-hydrolase XTH9 (XTH9) mR

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN016J16+ GAAATAAATAATGTTTATTAATTGCAA
rJMFF018B14- TGTTTATTAATTGC-A
rJMFF004L17- TGTTTATTAATTGCAA
                      ____________________________________________________________
consensus GAAATAAATAATGTTTATTAATTGCAA
 
. : . : . : . : . : . :
JMFN016J16+ TCCATATATACATTACATATATATGAGTGGATTACATACAATCTAGCTTAGCTAGATAAT
rJMFF018B14- TCCATATATACATTACATATATATGAGTGGATTACATACAATCTAGCTTAGCTAGATAAT
rJMFF004L17- TCCATATATACATTACATATATATGAGTGGATTACATACAATCTAGCTTAGCTAGATAAT
                      ____________________________________________________________
consensus TCCATATATACATTACATATATATGAGTGGATTACATACAATCTAGCTTAGCTAGATAAT
 
. : . : . : . : . : . :
JMFN016J16+ AATAACCTATCTACAAAATGAGAAATAATAATGAATTGAATCTCATGCATTATTATTGAT
rJMFF018B14- AATAACCTATCTACAAAATGAGAAATAATAATGAATTGAATCTCATGCATTATTATTGAT
rJMFF004L17- AATAACCTATCTACAAAATGAGAAATAATAATGAATTGAATCTCATGCATTATTATTGAT
                      ____________________________________________________________
consensus AATAACCTATCTACAAAATGAGAAATAATAATGAATTGAATCTCATGCATTATTATTGAT
 
. : . : . : . : . : . :
JMFN016J16+ CGATCTGTAACGACGCACGCGAGTGGCCGGGCGGCAACTTAAATTATTTAGGCTGTGGGC
rJMFF018B14- CGATCTGTAACGACGCACGCGAGTGGCCGGGCGGCAACTTAAATTATTTAGGCTGTGGGC
rJMFF004L17- CGATCTGTAACGACGCACGCGAGTGGCCGGGCGGCAACTTAAATTATTTAGGCTGTGGGC
                      ____________________________________________________________
consensus CGATCTGTAACGACGCACGCGAGTGGCCGGGCGGCAACTTAAATTATTTAGGCTGTGGGC
 
. : . : . : . : . : . :
JMFN016J16+ CTGCGGGTTTGCATTCAGCAGGAGGGTTGCCCCCGAAACGCTTGTTATCAGTGCAGTAAT
rJMFF018B14- CTGCGGGTTTGCATTCAGCAGGAGGGTTGCCCCCGAAACGCTTGTTATCAGTGCAGTAAT
rJMFF004L17- CTGCGGGTTTGCATTCAGCAGGAGGGTTGCCCCCGAAACGCTTGTTATCAGTGCAGTAAT
                      ____________________________________________________________
consensus CTGCGGGTTTGCATTCAGCAGGAGGGTTGCCCCCGAAACGCTTGTTATCAGTGCAGTAAT
 
. : . : . : . : . : . :
JMFN016J16+ TGTAGACCCTATTCTTTGTTCGTACGCCTTGGAGTTTATTATTGGCATCGGCATCAAGCG
rJMFF018B14- TGTAGACCCTATTCTTTGTTCGTACGCCTTGGAGTTTATTATTGGCATCGGCATCAAGCG
rJMFF004L17- TGTAGACCCTATTCTTTGTTCGTACGCCTTGGAGTTTATTATTGGCATCGGCATCAAGCG
                      ____________________________________________________________
consensus TGTAGACCCTATTCTTTGTTCGTACGCCTTGGAGTTTATTATTGGCATCGGCATCAAGCG
 
. : . : . : . : . : . :
JMFN016J16+ CATACTTTCCCCATGGCTTACTATCGGCGCAGGAGGAAGTTCCGACACAACCGTCGATAA
rJMFF018B14- CATACTTTCCCCATGGCTTACTATCGGCGCAGGAGGAAGTTCCGACACAACCGTCGATAA
rJMFF004L17- CATACTTTCCCCATGGCTTACTATCGGCGCAGGAGGAAGTTCCGACACAACCGTCGATAA
                      ____________________________________________________________
consensus CATACTTTCCCCATGGCTTACTATCGGCGCAGGAGGAAGTTCCGACACAACCGTCGATAA
 
. : . : . : . : . : . :
JMFN016J16+ CAAAGTTTTTGTAGTAGGCAGTGAAGGGAGCTTTTGACCAATCTACCTTCACATCTCCTC
rJMFF018B14- CAAAGTTTTTGTAGTAGGCAGTGAAGGGAGCTTTTGACCAATCTACCTTCACATCTCCTC
rJMFF004L17- CAAAGTTTTTGTAGTAGGCAGTGAAGGGAGCTTTTGACCAATCTACCTTCACATCTCCTC
                      ____________________________________________________________
consensus CAAAGTTTTTGTAGTAGGCAGTGAAGGGAGCTTTTGACCAATCTACCTTCACATCTCCTC
 
. : . : . : . : . : . :
JMFN016J16+ CCTGGGTTGCCCAATCAGACGCTTCCCACAAGCTGCAGAATACTTTCATGGGCTTGCTCT
rJMFF018B14- CCTGGGTTGCCCAATCAGACGCTTCCCACAAGCTGCAGAATACTTTCATGGGCTTGCTCT
rJMFF004L17- CCTGGGTTGCCCAATCAGACGCTTCCCACAAGCTGCAGAATACTTTCATGGGCTTGCTCT
JMFN043K24+ GGTTGCCCAATCAGACGCTTCCCACAAGCTGCAGAATACTTTCATGGGCTTGCTCT
                      ____________________________________________________________
consensus CCTGGGTTGCCCAATCAGACGCTTCCCACAAGCTGCAGAATACTTTCATGGGCTTGCTCT
 
. : . : . : . : . : . :
JMFN016J16+ TTGGGAATGGAACCCCAACATTTTCGTGATTCTCGTATACTCTAATCGGAACGTTATCCA
rJMFF018B14- TTGGGAATGGAACCCCAACATTTTCGTGATTCTCGTATACTCTAATCGGAACGTTATCCA
rJMFF004L17- TTGGGAATGGAACCCCAACATTTTCGTGATTCTCGTATACTCTAATCGGAACGTTATCCA
JMFN043K24+ TTGGGAATGGAACCCCAACATTTTCGTGATTCTCGTATACTCTAATCGGAACGTTATCCA
                      ____________________________________________________________
consensus TTGGGAATGGAACCCCAACATTTTCGTGATTCTCGTATACTCTAATCGGAACGTTATCCA
 
. : . : . : . : . : . :
JMFN016J16+ CCAACCAAACAAT
rJMFF018B14- CCAACCAAACAATTCTTTGTGAGTTCCAGATAATAGTGTAATCGTGATATGCGGCTGTTG
rJMFF004L17- CCAACCAAACAATTCTTTGTGAGTTCCAGATAATAGTGTAATCGTGATATGCGGCTGTTG
JMFN043K24+ CCAACCAAACAATTCTTTGTGAGTTCCAGATAATAGTGTAATCGTGATATGCGGCTGTTG
                      ____________________________________________________________
consensus CCAACCAAACAATTCTTTGTGAGTTCCAGATAATAGTGTAATCGTGATATGCGGCTGTTG
 
. : . : . : . : . : . :
rJMFF018B14- GGTCAAACCAGAGATGGAACTGTTGCTCCCTGTCACCTTTCCCATCAGCAAATACATTGG
rJMFF004L17- GGTCGAACCAGAGATGGAACTGTTGCTCCCTGTCACCTTTCCCATCAGCAAATACATTGG
JMFN043K24+ GGTCAAACCAGAGATGGAACTGTTGCTCCCTGTCACCTTTCCCATCAGCAAATACATTGG
                      ____________________________________________________________
consensus GGTCAAACCAGAGATGGAACTGTTGCTCCCTGTCACCTTTCCCATCAGCAAATACATTGG
 
. : . : . : . : . : . :
rJMFF018B14- TATGGACTGT
rJMFF004L17- TATGGACTGTGTAAGGCTGAAAAGTAGCATTCCCTAAGAATTCAAAGTCCACTTCATCGT
JMFN043K24+ TATGGACTGTGTAAGGCTGAAAAGTAGCATTCCCTAAGAATTCAAAGTCCACTTCATCGT
                      ____________________________________________________________
consensus TATGGACTGTGTAAGGCTGAAAAGTAGCATTCCCTAAGAATTCAAAGTCCACTTCATCGT
 
. : . : . : . : . : . :
rJMFF004L17- GCGCTTGTCCT
JMFN043K24+ GCGCTTGTCCTATAGGTGATGTTAGATAGAAGGTGGTGACAGTGCCAGCCGAGAAGCCTT
                      ____________________________________________________________
consensus GCGCTTGTCCTATAGGTGATGTTAGATAGAAGGTGGTGACAGTGCCAGCCGAGAAGCCTT
 
. : . : . : . : . : . :
JMFN043K24+ TCACTAACTTCATTTGCATGTCGAATCTGCCGAACAGGTACTCATTTTTGGTATTGAAAC
                      ____________________________________________________________
consensus TCACTAACTTCATTTGCATGTCGAATCTGCCGAACAGGTACTCATTTTTGGTATTGAAAC
 
. : . : . : . : . : . :
JMFN043K24+ CAAAACCAGTTTGTTGGTCAAGATTCAGGGCCATCGTGTTGCCGTTGTCTTGCACTTGCC
                      ____________________________________________________________
consensus CAAAACCAGTTTGTTGGTCAAGATTCAGGGCCATCGTGTTGCCGTTGTCTTGCACTTGCC
 
. : . : . : . : . : . :
JMFN043K24+ CAAGATGATTCCCAAAATACATTTGGACATCATTGTTGAAGTTAAGCGGGGGCGGGGGCA
                      ____________________________________________________________
consensus CAAGATGATTCCCAAAATACATTTGGACATCATTGTTGAAGTTAAGCGGGGGCGGGGGCA
 
. : . : . : . : . : . :
JMFN043K24+ CGGCTAATGCCACACCTACCAGGCTGCACGCCACCACACCTATTATCATTATCATACAAA
                      ____________________________________________________________
consensus CGGCTAATGCCACACCTACCAGGCTGCACGCCACCACACCTATTATCATTATCATACAAA