Previous Contig 002781:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN006G09Sequence530002781 (5)gb:AB010072_15109131e-22Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MEE6.>gb:AY088784_15737
JMFN018C19Sequence524002781 (5)gb:AB010072_15109131e-22Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MEE6.>gb:AY088784_15737
JMFN042B20Sequence478002781 (5)gb:AB010072_15109138e-23Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MEE6.>gb:AY088784_15737
JMFN043J19Sequence564002781 (5)gb:AB010072_15109131e-22Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MEE6.>gb:AY088784_15737
JMFN044G22Sequence500002781 (5)gb:AB010072_15109135e-21Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MEE6.>gb:AY088784_15737

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN006G09+ GAAATTTAAGCATATTCTAATTTTAC
                      ____________________________________________________________
consensus GAAATTTAAGCATATTCTAATTTTAC
 
. : . : . : . : . : . :
JMFN006G09+ TGTCAAACTTTTACCCATGGCTACAAATTGGAAATCGAAATCAATCTAACCCAAAAAACG
JMFN018C19+ AACCCAAAAAACG
JMFN042B20+ AACCCAAAAAACG
JMFN043J19+ TAACCCAAAAAACG
                      ____________________________________________________________
consensus TGTCAAACTTTTACCCATGGCTACAAATTGGAAATCGAAATCAATCTAACCCAAAAAACG
 
. : . : . : . : . : . :
JMFN006G09+ ATGGATAGTTTTCTAATCTCCAACAGATAATTCTTCAGTACATGGATTAGAGGAGTTTAT
JMFN018C19+ ATGGATAGTTTTCTAATCTCCAACAGATAATTCTTCAGTACATGGATTAGAGGAGTTTAT
JMFN044G22+ AATCTCCAACAGATAATTCTTCAGTACATGGATTAGAGGAGTTTAT
JMFN042B20+ ATGGATAGTTTTCTAATCTCCAACAGATAATTCTTCAGTACATGGATTAGAGGAGTTTAT
JMFN043J19+ ATGGATAGTTTTCTAATCTCCAACAGATAATTCTTCAGTACATGGATTAGAGGAGTTTAT
                      ____________________________________________________________
consensus ATGGATAGTTTTCTAATCTCCAACAGATAATTCTTCAGTACATGGATTAGAGGAGTTTAT
 
. : . : . : . : . : . :
JMFN006G09+ GAACAAGGAAGAAAAATGCATATATAGAGCTAGATCTGAAATAGGAAAATTACTCACGAG
JMFN018C19+ GAACAAGGAAGAAAAATGCATATATAGAGCTAGATCTGAAATAGGAAAATTACTCACGAG
JMFN044G22+ GAACAAGGAAGAAAAATGCATATATAGAGCTAGATCTGAAATAGGAAAATTACTCACGAG
JMFN042B20+ GAACAAGGAAGAAAAATGCATATATAGAGCTAGATCTGAAATAGGAAAATTACTCACGAG
JMFN043J19+ GAACAAGGAAGAAAAATGCATATATAGAGCTAGATCTGAAATAGGAAAATTACTCACGAG
                      ____________________________________________________________
consensus GAACAAGGAAGAAAAATGCATATATAGAGCTAGATCTGAAATAGGAAAATTACTCACGAG
 
. : . : . : . : . : . :
JMFN006G09+ ATTACGGAGTAGAAATGCTTCCAGTAGAGTAGCGAAGGATGAGGATGGGATCGGATCGGA
JMFN018C19+ ATTACGGAGTAGAAATGCTTCCAGTAGAGTAGCGAAGGATGAGGATGGGATCGGATCGGA
JMFN044G22+ ATTACGGAGTAGAAATGCTTCCAGTAGAGTAGCGAAGGATGAGGATGGGATCGGATCGGA
JMFN042B20+ ATTACGGAGTAGAAATGCTTCCAGTAGAGTAGCGAAGGATGAGGATGGGATCGGATCGGA
JMFN043J19+ ATTACGGAGTAGAAATGCTTCCAGTAGAGTAGCGAAGGATGAGGATGGGATCGGATCGGA
                      ____________________________________________________________
consensus ATTACGGAGTAGAAATGCTTCCAGTAGAGTAGCGAAGGATGAGGATGGGATCGGATCGGA
 
. : . : . : . : . : . :
JMFN006G09+ TCAGCCGGTATAGATGTGAACACGAACGGCCAGGATGAGAATAGCGTAGATAGCGAAGAA
JMFN018C19+ TCAGCCGGTATAGATGTGAACACGAACGGCCAGGATGAGAATAGCGTAGATAGCGAAGAA
JMFN044G22+ TCAGCCGGTATAGATGTGAACACGAACGGCCAGGATGAGAATAGCGTAGATAGCGAAGAA
JMFN042B20+ TCAGCCGGTATAGATGTGAACACGAACGGCCAGGATGAGAATAGCGTAGATAGCGAAGAA
JMFN043J19+ TCAGCCGGTATAGATGTGAACACGAACGGCCAGGATGAGAATAGCGTAGATAGCGAAGAA
                      ____________________________________________________________
consensus TCAGCCGGTATAGATGTGAACACGAACGGCCAGGATGAGAATAGCGTAGATAGCGAAGAA
 
. : . : . : . : . : . :
JMFN006G09+ AAACAGAGTGTGAAGAGCAATAGCCTTGCCATTGGTCTTCATGGTTCCGAACTCGAGCGG
JMFN018C19+ AAACAGAGTGTGAAGAGCAATAGCCTTGCCATTGGTCTTCATGGTTCCGAACTCGAGCGG
JMFN044G22+ AAACAGAGTGTGAAGAGCAATAGCCTTGCCATTGGTCTTCATGGTTCCGAACTCGAGCGG
JMFN042B20+ AAACAGAGTGTGAAGAGCAATAGCCTTGCCATTGGTCTTCATGGTTCCGAACTCGAGCGG
JMFN043J19+ AAACAGAGTGTGAAGAGCAATAGCCTTGCCATTGGTCTTCATGGTTCCGAACTCGAGCGG
                      ____________________________________________________________
consensus AAACAGAGTGTGAAGAGCAATAGCCTTGCCATTGGTCTTCATGGTTCCGAACTCGAGCGG
 
. : . : . : . : . : . :
JMFN006G09+ GCGATTGTTTCCCGGAATCTGGAAAAGCAGGCCCGGCTGCAGCAGTATAAAGAGCACCAC
JMFN018C19+ GCGATTGTTTCCCGGAATCTGGAAAAGCAGGCCCGGCTGCAGCAGTATAAAGAGCACCAC
JMFN044G22+ GCGATTGTTTCCCGGAATCTGGAAAAGCAGGCCCGGCTGCAGCAGTATAAAGAGCACCAC
JMFN042B20+ GCGATTGTTTCCCGGAATCTGGAAAAGCAGGCCCGGCTGCAGCAGTATAAAGAGCACCAC
JMFN043J19+ GCGATTGTTTCCCGGAATCTGGAAAAGCAGGCCCGGCTGCAGCAGTATAAAGAGCACCAC
                      ____________________________________________________________
consensus GCGATTGTTTCCCGGAATCTGGAAAAGCAGGCCCGGCTGCAGCAGTATAAAGAGCACCAC
 
. : . : . : . : . : . :
JMFN006G09+ TCCGATTACCACCGGTGCCCAGTCCGCCATTGCTCTGCGATTCCGATCTGTACGTTAGCA
JMFN018C19+ TCCGATTACCACCGGTGCCCAGTCCGCCATTGCTCTGCGATTCCGATCTGTACGTTAGCA
JMFN044G22+ TCCGATTACCACCGGTGCCTAGTCCGCCATTGCTCTGCGATTCCGATCTGTACGTTAGCA
JMFN042B20+ TCCGATTACCACCGGTGCCCAGTCCGCCATTGCTCTGCGATTCCGATCTGTACGTTAGCA
JMFN043J19+ TCCGATTACCACCGGTGCCCAGTCCGCCATTGCTCTGCGATTCCGATCTGTACGTTAGCA
                      ____________________________________________________________
consensus TCCGATTACCACCGGTGCCCAGTCCGCCATTGCTCTGCGATTCCGATCTGTACGTTAGCA
 
. : . : . : . : . : . :
JMFN006G09+ GAGATGATGACTAGATGAGAGTGA
JMFN018C19+ GAGATGATGACTAGATGAGAGTGATAGGGGAAGGAGCAAAGGCAAAGGGCAGAAAGTAGT
JMFN044G22+ GAGATGATGACTAGATGAGAGTGATAGGGGAAGGAGCAAAGGCAAAGGGCAGAAAGTAGT
JMFN042B20+ GAGATGATGACTAGATGAGAGTGATAGGGGAAGGAGCAAAG
JMFN043J19+ GAGATGATGACTAGATGAGAGTGATAGGGGAAGGAGCAAAGGCAAAGGGCAGAAAGTAGT
                      ____________________________________________________________
consensus GAGATGATGACTAGATGAGAGTGATAGGGGAAGGAGCAAAGGCAAAGGGCAGAAAGTAGT
 
. : . : . : . : . : . :
JMFN018C19+ AGAAACAGCTAGCTCTTCACAACCTTTTTGG
JMFN044G22+ AGAAACAGCTAGCTCTTCACAACCTTTTTGG
JMFN043J19+ AGAAACAGCTAGCTCTTCACAACCTTTTTGGCTAGTCTACCCCTGACTAGTTACAAACGG
                      ____________________________________________________________
consensus AGAAACAGCTAGCTCTTCACAACCTTTTTGGCTAGTCTACCCCTGACTAGTTACAAACGG