Previous Contig 002772:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN018P01Sequence622002772 (2)
JMFN043B16Sequence502002772 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN018P01- C
                      ____________________________________________________________
consensus C
 
. : . : . : . : . : . :
JMFN018P01- TCTCGGAGAGAGTTTTCGAGAAAGATAAGAAAGTTAGAGCCGTTGGATTGATTACATTGT
                      ____________________________________________________________
consensus TCTCGGAGAGAGTTTTCGAGAAAGATAAGAAAGTTAGAGCCGTTGGATTGATTACATTGT
 
. : . : . : . : . : . :
JMFN018P01- GATGATGGATTTGAAATGCGCTGCCGTGGTGGCATTTGTGTGCTTGATCGTGGCCGGAGT
                      ____________________________________________________________
consensus GATGATGGATTTGAAATGCGCTGCCGTGGTGGCATTTGTGTGCTTGATCGTGGCCGGAGT
 
. : . : . : . : . : . :
JMFN018P01- TGTTGGCCAAGCGCCGCCTGCTCCTCCCACGTCAACTCCTGCGCCGCCGACACCTACCAC
                      ____________________________________________________________
consensus TGTTGGCCAAGCGCCGCCTGCTCCTCCCACGTCAACTCCTGCGCCGCCGACACCTACCAC
 
. : . : . : . : . : . :
JMFN018P01- CTCCAGCTTCACCGCCGCCAACTCCACCGGCATCTCCCCCACCAGTCACCACACCGCCTG
                      ____________________________________________________________
consensus CTCCAGCTTCACCGCCGCCAACTCCACCGGCATCTCCCCCACCAGTCACCACACCGCCTG
 
. : . : . : . : . : . :
JMFN018P01- CCAGCCCTCCGCCGTCAAGTCCTCCTCCAACCCCCGCTAGCCCCCCGCCGTCTCCCCTAT
JMFN043B16+ AGCCCCCCGCCGTCTCCCCTAT
                      ____________________________________________________________
consensus CCAGCCCTCCGCCGTCAAGTCCTCCTCCAACCCCCGCTAGCCCCCCGCCGTCTCCCCTAT
 
. : . : . : . : . : . :
JMFN018P01- CTCCACCGCCGCCAACTCCTTCCCCTCCACCTCCGGCAGCTCCTACACCTTCCCCTCTCG
JMFN043B16+ CTCCACCGCCGCCAACTCCTTCCCCTCCACCTCCGGCAGCTCCTACACCTTCCCCTCTCG
                      ____________________________________________________________
consensus CTCCACCGCCGCCAACTCCTTCCCCTCCACCTCCGGCAGCTCCTACACCTTCCCCTCTCG
 
. : . : . : . : . : . :
JMFN018P01- CATCTCCGGCTCCGGCTCCCAGCCTTAAGAAGCCCAAGAAGAGTCCGGCACCGTCGCCTT
JMFN043B16+ CATCTCCGGCTCCGGCTCCCAGCCTTAAGAAGCCCAAGAAGAGTCCGGCACCGTCGCCTT
                      ____________________________________________________________
consensus CATCTCCGGCTCCGGCTCCCAGCCTTAAGAAGCCCAAGAAGAGTCCGGCACCGTCGCCTT
 
. : . : . : . : . : . :
JMFN018P01- CCACATTCAGTTCCCCATTACCCCCGTCCGGAGCTCCGGCCCCGAGCCTTGGATCTCTCT
JMFN043B16+ CCACATTCAGTTCCCCATTACCCCCGTCCGGAGCTCCGGCCCCGAGCCTTGGATCTCTCT
                      ____________________________________________________________
consensus CCACATTCAGTTCCCCATTACCCCCGTCCGGAGCTCCGGCCCCGAGCCTTGGATCTCTCT
 
. : . : . : . : . : . :
JMFN018P01- CTCCTGCTCCATCGGCCACCGATCAGAGTGTAGCAGAGAGCATTAGGACGGTGATGAAGA
JMFN043B16+ CTCCTGCTCCATCGGCCACCGATCAGAGTGGAGCAGAGAGCATTAGGACGGTGATGAAGA
                      ____________________________________________________________
consensus CTCCTGCTCCATCGGCCACCGATCAGAGTGTAGCAGAGAGCATTAGGACGGTGATGAAGA
 
. : . : . : . : . : . :
JMFN018P01- TGGCGGCGAGCATGGTGGCGGCGTTTGGCGCCATGAATTTGCTGCTAC-TTAGATATATT
JMFN043B16+ TGGCGGCGAGCATGGTGGCGGCGTTTGGCGCCATGAATTTGCTGCTACTTTAGATATATT
                      ____________________________________________________________
consensus TGGCGGCGAGCATGGTGGCGGCGTTTGGCGCCATGAATTTGCTGCTACTTTAGATATATT
 
. : . : . : . : . : . :
JMFN018P01- ATGTGCGGATGGAGTTGCCATC
JMFN043B16+ ATGTGCGGATGGAGTTGCCATCAGGCCGGCCTATCTTACATCTATTTGATCTGCATTTTA
                      ____________________________________________________________
consensus ATGTGCGGATGGAGTTGCCATCAGGCCGGCCTATCTTACATCTATTTGATCTGCATTTTA
 
. : . : . : . : . : . :
JMFN043B16+ TATGCATTTATTTACTTTGATTCTTTGAGATTATTGGAGCTTTTTGTATTGAGCTGTTTG
                      ____________________________________________________________
consensus TATGCATTTATTTACTTTGATTCTTTGAGATTATTGGAGCTTTTTGTATTGAGCTGTTTG
 
. : . : . : . : . : . :
JMFN043B16+ CTTTCGAATTCATAATTTCATTCGGATXXXXXXXXXXXXXXXXXXCTCGAGACTAGTTCT
                      ____________________________________________________________
consensus CTTTCGAATTCATAATTTCATTCGGATNNNNNNNNNNNNNNNNNNCTCGAGACTAGTTCT