Previous Contig 002766:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030F06Sequence570014663pir|C84716|C847162e-10hypothetical protein At2g31080 [imported] - Arabidopsis thaliana>gb:AC005311_153663002766 (10)gb:AC007843_15362562e-17Arabidopsis thaliana chromosome I BAC F28G4 genomic sequence, complete sequence.
JMFN003I05Sequence623002766 (10)gb:AC007843_15362561e-19Arabidopsis thaliana chromosome I BAC F28G4 genomic sequence, complete sequence.
JMFN020O07Sequence344002766 (10)gb:AC007843_15362565e-06Arabidopsis thaliana chromosome I BAC F28G4 genomic sequence, complete sequence.
JMFN025G13Sequence656002766 (10)gb:AP002032_18214927e-19Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MPH15.
JMFN028P16Sequence609002766 (10)gb:AP002032_18214924e-18Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MPH15.
JMFN035I19Sequence561002766 (10)pir|H85088|H850881e-19hypothetical protein AT4g08830 [imported] - Arabidopsis thaliana>gb:ATCHRIV25_15
JMFN042O17Sequence636002766 (10)pir|C84488|C844882e-17hypothetical protein At2g07730 [imported] - Arabidopsis thaliana>gb:AC004483_153
JMFN043C24Sequence343002766 (10)gb:AC007843_15362565e-06Arabidopsis thaliana chromosome I BAC F28G4 genomic sequence, complete sequence.
JMFS037B04Sequence574002766 (10)gb:AP002032_18214922e-15Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MPH15.
JMFS086H03Sequence630002766 (10)pir|H84677|H846771e-24hypothetical protein At2g27870 [imported] - Arabidopsis thaliana>gb:AC005824_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS037B04+ TGG
JMFN028P16+ TGG
                      ____________________________________________________________
consensus TGG
 
. : . : . : . : . : . :
JMFS037B04+ TAATTAGTACTTAGTATTATTTTTAAACTTTGGATTGCTATTTTGTTATATTTTTTTTTT
JMFN028P16+ TAATTAGTACTTAGTATTATTTTTAAACTTTGGATTGCTATTTTGTTATA-TTTTTTTTT
JMFN025G13+ TTAGTATTA-TTTTAAACTTTGGATTGCTATTTNGTTATA--TTTTTTTT
rJMFF030F06- TTAGTATTATTTTTAAACTTTGGATTGCTATTTTGTTATA-TTTTTTTTT
                      ____________________________________________________________
consensus TAATTAGTACTTAGTATTATTTTTAAACTTTGGATTGCTATTTTGTTATA-TTTTTTTTT
 
. : . : . : . : . : . :
JMFS037B04+ TGATCGAAAGGACGGGGTAGACCCGGGGGCGACTCAAGCTACTGGTTGAGTCTCCCTAAC
JMFN028P16+ TGATCGAAAGGACGGGGTAGACCCGGGGGCGACTCAAGCTACTGGTTGAGTCTCCCTAAC
JMFN043C24+ ATCGAAAGGACGGGGTAGACCCGGGGGCGACTCAAGCTACTGGTTGAGTCTCCCTAAC
JMFN020O07+ GATCGAAAGGACGGGGTAGACCCGGGGGCGACTCAAGCTACTGGTTGAGTCTCCCTAAC
JMFN025G13+ TGATCGAAAGGACGGGGTAGACCCGGGGGCGACTCAAGCTACTGGTTGAGTCTCCCTAAC
rJMFF030F06- TGATCGAAAGGACGGGGTANACCCGGGGGCGACTCAAGCTACTGGTTGAGTCTCCCTAAC
JMFN003I05+ ACGGGGTAGACCCGGGGGCGACTCAAGCTACTGGTTGAGTCTCCCTAAC
                      ____________________________________________________________
consensus TGATCGAAAGGACGGGGTAGACCCGGGGGCGACTCAAGCTACTGGTTGAGTCTCCCTAAC
 
. : . : . : . : . : . :
JMFS037B04+ TCTGCGAGCACTTGTAACACGGGCTATATCTTGGAGGTAAGCCTCTTTGCTAATGATGGG
JMFN028P16+ TCTGCGAGCACTTGTAACACGGGCTATATCTTGGAGGTAAGCCTCTTTGCTAATGATGGG
JMFN043C24+ TCTGCGAGCACTTGTAACACGGGCTATATCTTGGAGGTAAGCCTCTTTGCTAATGATGGG
JMFN020O07+ TCTGCGAGCACTTGTAACACGGGCTATATCTTGGAGGTAAGCCTCTTTGCTAATGATGGG
JMFN025G13+ TCTGCGAGCACTTGTAACACGGGCTATATCTTGGAGGTAAGCCTCTTTGCTAATGATGGG
rJMFF030F06- TCTGCGAGCACTTGTAACACGGGCTATATCTTGGAGGTAAGCC-CTTTGCTAATGATGGG
JMFN003I05+ TCTGCGAGCACTTGTAACACGGGCTATATCTTGGAGGTAAGCCTCTTTGCTAATGATGGG
                      ____________________________________________________________
consensus TCTGCGAGCACTTGTAACACGGGCTATATCTTGGAGGTAAGCCTCTTTGCTAATGATGGG
 
. : . : . : . : . : . :
JMFS037B04+ GCACGAGCTGAAAGTTGTCCAAGCATCACTTTGGAAGGCGCCGTAACCGGCTAAGGCATC
JMFN028P16+ GCACGAGCTGAAAGTTGTCCAAGCATCACTTTGGAAGGCGCCGTAACCGGCTAAGGCATC
JMFN043C24+ GCACGAGCTGAAAGTTGTCCAAGCATCACTTTGGAAGGCGCCGTAACCGGCTAAGGCATC
JMFN020O07+ GCACGAGCTGAAAGTTGTCCAAGCATCACTTTGGAAGGCGCCGTAACCGGCTAAGGCATC
JMFN025G13+ GCACGAGCTGAAAGTTGTCCAAGCATCACTTTGGAAGGCGCCGTAACCGGCTAAGGCATC
rJMFF030F06- GCACGAGCTGAAAGTTGTCCAAGCATCACTTTGGAAGGCGCCGTAACCGGCTAAGGCATC
JMFN003I05+ GCACGAGCTGAAAGTTGTCCAAGCATCACTTTGGAAGGCGCCGTAACCGGCTAAGGCATC
JMFS086H03+ CGAGCTGAAAGTTGTCCAAGCATCACTTTGGAAGGCGCCGTAACCGGCTAAGGCATC
                      ____________________________________________________________
consensus GCACGAGCTGAAAGTTGTCCAAGCATCACTTTGGAAGGCGCCGTAACCGGCTAAGGCATC
 
. : . : . : . : . : . :
JMFS037B04+ TGCAACCCTGTTTTGCTCTCTATAGACAGCGCGAATGGAGATTTTCCAATCCTTCGTTAG
JMFN028P16+ TGCAACCCTGTTTTGCTCTCTATAGACAGCGCGAATGGAGATTTTCCAATCCTTCGTTAG
JMFN043C24+ TGCAACCCTGTTTTGCTCTCTATAGACAGCGCGAATGGAGATTTTCCAATCCTTCGTTAG
JMFN020O07+ TGCAACCCTGTTTTGCTCTCTATAGACAGCGCGAATGGAGATTTTCCAATCCTTCGTTAG
JMFN025G13+ TGCAACCCTGTTTTGCTCTCTATAGACAGCGCGAATGGAGATTTTCCAATCCTTCGTTAG
rJMFF030F06- TGCAACCCTGTTTTGCTCTCTATANACAGCGCGAATGGANATTTTCCAATCCTTCGTTAG
JMFN003I05+ TGCAACCCTGTTTTGCTCTCTATAGACAGCGCGAATGGAGATTTTCCAATCCTTCGTTAG
JMFS086H03+ TGCAACCCTGTTTTGCTCTCTATAGACAGCGCGAATGGAGATTTTCCAATCCTTCGTTAG
                      ____________________________________________________________
consensus TGCAACCCTGTTTTGCTCTCTATAGACAGCGCGAATGGAGATTTTCCAATCCTTCGTTAG
 
. : . : . : . : . : . :
JMFS037B04+ CCATAATCTGGCTTCCTCAATAATGCCTTGAATAGGACCCCGAAGGTTATCACTGGCCTG
JMFN028P16+ CCATAATCTGGCTTCCTCAATAATGCCTTGAATAGGACCCCGAAGGTTATCACTGGCCTG
JMFN043C24+ CCATAATCTGGCTTCCTCAATAATGCCTTGAATAGGACCCCGAAGGTTATCACTGGCCTG
JMFN020O07+ CCATAATCTGGCTTCCTCAATAATGCCTTGAATAGGACCCCGAAGGTTATCACTGGCCTG
JMFN025G13+ CCATAATCTGGCTTCCTCAATAATGCCTTGAATAGGACCCCGAAGGTTATCACTGGCCTG
rJMFF030F06- CCATAATCTGGCTTCCTCAATAATGCCTTGAATAGGACCCCGAAGGTTATCACTGGCCTG
JMFN003I05+ CCATAATCTGGCTTCCTCAATAATGCCTTGAATAGGACCCCGAAGGTTATCACTGGCCTG
JMFS086H03+ CCATAATCTGGCTTCCTCAATAATGCCTTGAATAGGACCCCGAAGGTTATCACTGGCCTG
                      ____________________________________________________________
consensus CCATAATCTGGCTTCCTCAATAATGCCTTGAATAGGACCCCGAAGGTTATCACTGGCCTG
 
. : . : . : . : . : . :
JMFS037B04+ AATCCATTCCACCACCTTTCTAGCATCGCTCTGGATCTCAGCTTCGCGAACTCCTCTCTC
JMFN028P16+ AATCCATTCCACCACCTTTCTAGCATCGCTCTGGATCTCAGCTTCGCGAACTCCTCTCTC
JMFN043C24+ AATCCATTCCACCACCTTTCTAGCATCGCTCTGGAACTCAGC
JMFN020O07+ AATCCATTCCACCACCTTTCTAGCATCGCTCTGGAACTCAGC
JMFN025G13+ AATCCATTCCACCACCTTTCTAGCATCGCTCTGGATCTCAGCTTCGCGAACTCCTCTTTC
rJMFF030F06- AATCCATTCCACCACCTTTCTAGCATCGCTCTGGATCTCAGCTTCGCGAACTCCTCTCTC
JMFN003I05+ AATCCATTCCACCACCTTTCTAGCATCGCTCTGGATCTCAGCTTCGCGAACTCCTCTCTC
JMFS086H03+ AATCCATTCCACCACCTTTCTAGCATCGCTCTGGATCTCAGCTTCGCGAACTCCTCTCTC
                      ____________________________________________________________
consensus AATCCATTCCACCACCTTTCTAGCATCGCTCTGGATCTCAGCTTCGCGAACTCCTCTCTC
 
. : . : . : . : . : . :
JMFS037B04+ CCAAAGCCACTGCATTCCCAAGACAATGGCTTTAGCTTCTATGGCTTCCGGGGTCTCCAG
JMFN028P16+ CCAAAGCCACTGCATTCCCAAGACAATGGCTTTAGCTTCTATGGCTTCCGGGGTCTCCAG
JMFN025G13+ CCAAAGCCACTGCATTCCCAAGACAATGGCTTTAGCTTCTATGGCTTCCGGGGTCTCCAG
rJMFF030F06- CCAAAGCCACTGCATTCCCAANACAATGGCTTTAGCTTCTATGGCTTCCGGGGTCTCCAG
JMFN003I05+ CCAAAGCCACTGCATTCCCAAGACAATGGCTTTAGCTTCTATGGCTTCCGGGGTCTCCAG
JMFS086H03+ CCAAAGCCACTGCATTCCCAAGACAATGGCTTTAGCTTCTATGGCTTCCGGGGTCTCCAG
JMFN035I19+ ACTGCATTCCCAAGACAATGGCTTTAGCTTCTATGGCTTCCGGGGTCTCCAG
                      ____________________________________________________________
consensus CCAAAGCCACTGCATTCCCAAGACAATGGCTTTAGCTTCTATGGCTTCCGGGGTCTCCAG
 
. : . : . : . : . : . :
JMFS037B04+ TGGTATTTTATACGCAAATCCTCCGAGCCACGTTCCTTTGTCCTCCCTGAGTGCACCTCC
JMFN028P16+ TGGTATTTTATACGCAAATCCTCCGAGCCACGTTCCTTTGTCCTCCCTGAGTGCACCTCC
JMFN025G13+ TGGTATTTTATACGCAAATCCTCCGAGCCACGTTCCTTTGTCCTCCCTGAGTGCACCTCC
rJMFF030F06- NGGTATTTTATACGCAAATCCTCCGAGCCACGTTCCTTTGTCCTCCCTGAGTGCACCTCC
JMFN003I05+ TGGTATTTTATACGCAAATCCTCCGAGCCACGTTCCTTTGTCCTCCCTGAGTGCACCTCC
JMFS086H03+ TGGTATTTTATACGCAAATCCTCCGAGCCACGTTCCTTTGTCCTCCCTGAGTGCACCTCC
JMFN035I19+ TGGTATTTTATACGCAAATCCTCCGAGCCACGTTCCTTTGTCCTCCCTGAGTGCACCTCC
                      ____________________________________________________________
consensus TGGTATTTTATACGCAAATCCTCCGAGCCACGTTCCTTTGTCCTCCCTGAGTGCACCTCC
 
. : . : . : . : . : . :
JMFS037B04+ TATCTCAACATTGTTTGTTGAAGCTTTGACA
JMFN028P16+ TATTCCAGCATTGTTTGTTGAAGCTTTGACACTGCCATCAATGTTGAGAGTGAGACGGCT
JMFN025G13+ TATTCCAGCATTGTTTGTTGAAGCTTTGACACTGCCATCAATGTTGAGAGTGAGACGGCT
rJMFF030F06- TATTCCAGCATTGTTTGTTGAAGCTTTGACACTGCCATCAATGTTGAGAGTGAGACGGCT
JMFN003I05+ TATTCCAGCATTGTTTGTTGAAGCTTTGACACTGCCATCAATGTTGAGAGTGAGACGGCT
JMFS086H03+ TATTCCAGCATTGTTTGTTGAAGCTTTGACACTGCCATCAATGTTGAGAGTGAGACGGCT
JMFN035I19+ TATTCCAGCATTGTTTGTTGAAGCTTTGACACTGCCATCAATGTTGAGAGTGAGACGGCT
                      ____________________________________________________________
consensus TATTCCAGCATTGTTTGTTGAAGCTTTGACACTGCCATCAATGTTGAGAGTGAGACGGCT
 
. : . : . : . : . : . :
JMFN028P16+ ATTCTTC
JMFN025G13+ ATTCTTCGAAGGATTCCAGCATAGGTGAACAGTTCGTTCCTTCGTTGTTCTTCCCTGCAT
rJMFF030F06- ATTCTTCGAAGGATTCCAGCATAGGTGAACAGTTCGTTCCTTCGTTGTTCTTCCCTGCAT
JMFN003I05+ ATTCTTCGAAGGATTCCAGCATAGGTGAACAGTTCGTTCCTTCGTTGTTCTTCCCTGCAT
JMFS086H03+ ATTCTTCGAAGGATTCCAGCATAGGTGAACAGTTCGTTCCTTCGTTGTTCTTCCCTGCAT
JMFN035I19+ ATTCTTCGAAGGATTCCAGCATAGGTGAACAGTTCGTTCCTTCGTTGTTCTTCCCTGCAT
                      ____________________________________________________________
consensus ATTCTTCGAAGGATTCCAGCATAGGTGAACAGTTCGTTCCTTCGTTGTTCTTCCCTGCAT
 
. : . : . : . : . : . :
JMFN025G13+ TTGCTCTTC
rJMFF030F06- TTGCTCTTCTCTCAC
JMFN003I05+ TTGCTCTTCTCTCACAAAAGCACGGCTGACTTCC
JMFS086H03+ TTGCTCTTCTCTCACAAAAGCACGGCTGACTTCCTCCTTCGCTTCTCTAATCCATGCGGC
JMFN035I19+ TTGCTCTTCTCTCACAAAAGCACGGCTGACTTCCTCCTTCGCTTCTCTAATCCATGCGGC
                      ____________________________________________________________
consensus TTGCTCTTCTCTCACAAAAGCACGGCTGACTTCCTCCTTCGCTTCTCTAATCCATGCGGC
 
. : . : . : . : . : . :
JMFS086H03+ TTTCCTTTGTGTACTCCAGGCTTCGTCTTTGAAGATTCTATTGTTTCTCCATCGCCAAAG
JMFN035I19+ TTTCCTTTGTGTACTCCAGGCTTCGTCTTTGAAGATTCTATTGTTTCTCCATCGCCAAAG
JMFN042O17+ GTCTTTGAAGATTCTATNGTTTCTCCATCGCCAAAG
                      ____________________________________________________________
consensus TTTCCTTTGTGTACTCCAGGCTTCGTCTTTGAAGATTCTATTGTTTCTCCATCGCCAAAG
 
. : . : . : . : . : . :
JMFS086H03+ CCACCACACCGTAATGGCAAAAACTCGAG
JMFN035I19+ CCACCACACCGTAATGGCAAAAATTCGAGGCCAATCTGTGTCGCCACCCTTCTTCTCACC
JMFN042O17+ CCACCACACCGTAATGGCAAAAATTCGAGGCCAATCTGTGTCGCCACCCTTCTTCTCACC
                      ____________________________________________________________
consensus CCACCACACCGTAATGGCAAAAATTCGAGGCCAATCTGTGTCGCCACCCTTCTTCTCACC
 
. : . : . : . : . : . :
JMFN035I19+ TGAAATGTTAGTTTCCAGCCAGGCTTGAAAGTTCTGTTGGTGCCAAGAGTCATACCTTTC
JMFN042O17+ TGAAATGTTAGTTTCCAGCCAGGCTTGAAAGTTCTGTTGGTGCCAAGAGTCATACCTTTC
                      ____________________________________________________________
consensus TGAAATGTTAGTTTCCAGCCAGGCTTGAAAGTTCTGTTGGTGCCAAGAGTCATACCTTTC
 
. : . : . : . : . : . :
JMFN035I19+ ATTCCCTGCAATAATTTTCCACACCTCCTTCGCATGCTTACATTTTCTGATGATGTGCTC
JMFN042O17+ ATTCCCTGCAATAATTTTCCACACCTCCTTCGCATGCTTACATTTTCTGATGATGTGCTC
                      ____________________________________________________________
consensus ATTCCCTGCAATAATTTTCCACACCTCCTTCGCATGCTTACATTTTCTGATGATGTGCTC
 
. : . : . : . : . : . :
JMFN035I19+ TATGGTCTCATCGCATTCTGGGCATACAC
JMFN042O17+ TATGGTCTCATCGCATTCTGGGCATACACCGCATCTGCCATCTCCAGTGAACCCTCTTCG
                      ____________________________________________________________
consensus TATGGTCTCATCGCATTCTGGGCATACACCGCATCTGCCATCTCCAGTGAACCCTCTTCG
 
. : . : . : . : . : . :
JMFN042O17+ ATATCTCTCTGCATTTCCCATTAGTCGGCCATGCATGGCAATCCAAAGGAGCGCTTTCAT
                      ____________________________________________________________
consensus ATATCTCTCTGCATTTCCCATTAGTCGGCCATGCATGGCAATCCAAAGGAGCGCTTTCAT
 
. : . : . : . : . : . :
JMFN042O17+ CTTGTTTGGTACTTTGATTTTCCACATCTTACCCCATACTGGATCCACCACCAAATATCA
                      ____________________________________________________________
consensus CTTGTTTGGTACTTTGATTTTCCACATCTTACCCCATACTGGATCCACCACCAAATATCA
 
. : . : . : . : . : . :
JMFN042O17+ ACAAACGCTTGCAAAATCATGAATTTATAGCCCGTTTGGTTCACGGAATCAATTTGGAGG
                      ____________________________________________________________
consensus ACAAACGCTTGCAAAATCATGAATTTATAGCCCGTTTGGTTCACGGAATCAATTTGGAGG
 
. : . : . : . : . : . :
JMFN042O17+ GAATAAGAATGTTATTCCATAGGGAATAGAATATGTAAGGAATAGAATAGAAATTGTATT
                      ____________________________________________________________
consensus GAATAAGAATGTTATTCCATAGGGAATAGAATATGTAAGGAATAGAATAGAAATTGTATT
 
. : . : . : . : . : . :
JMFN042O17+ CTGTTGTTTGGTTCAATGAAGGAATAGACTTTGGGAATTGTATTCAAACGTTTGGTTGGT
                      ____________________________________________________________
consensus CTGTTGTTTGGTTCAATGAAGGAATAGACTTTGGGAATTGTATTCAAACGTTTGGTTGGT
 
. : . : . : . : . : . :
JMFN042O17+ TAAGGAATAGAAATGGAATATATGTTTAAAAGGCTCACAGACTCGTAGAACAGAATTTGT
                      ____________________________________________________________
consensus TAAGGAATAGAAATGGAATATATGTTTAAAAGGCTCACAGACTCGTAGAACAGAATTTGT