Previous Contig 002764:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001B07Sequence563002764 (5)gb:AE005172_8904841e-41Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC006917_153468648002764 (5)gb:AE005172_8904843e-53Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC006917_153468
JMFN042M10Sequence540002764 (5)gb:AP006161_18611122e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:B126
JMSF052O12Sequence621002764 (5)gb:AE005172_8904844e-52Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC006917_153468746002764 (5)gb:AE005172_8904841e-53Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC006917_153468

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF001B07- AGTGCTTAAATACTTGAGAATTTCT
                      ____________________________________________________________
consensus AGTGCTTAAATACTTGAGAATTTCT
 
. : . : . : . : . : . :
JMFF001B07- GCTAACTTTGTTATCCAAAATTCCAATTCATAAAAACAAAATACTTTTCAATCTTCCATA
JMSF052O12- GTTATCCAAAATTCCAATTCATAAAAACAAAATACTTTTCAATCTTCCATA
rJMSF052O12+ GTTATCCAAAATTCCAATTCATAAAAACAAAATACTTTTCAATCTTCCATA
                      ____________________________________________________________
consensus GCTAACTTTGTTATCCAAAATTCCAATTCATAAAAACAAAATACTTTTCAATCTTCCATA
 
. : . : . : . : . : . :
JMFF001B07- GCCATGAATTCTTCTTCAGCTTCATCTGACTACCACAAATTCACACCGTCGCCGTACGGC
JMSF052O12- GCCATGAATTCTTCTTCAGCTTCATCTGACTACCACAAATTCACACCGTCGCCGTACGGC
rJMSF052O12+ GCCATGAATTCTTCTTCAGCTTCATCTGACTACCACAAATTCACACCGTCGCCGTACGGC
                      ____________________________________________________________
consensus GCCATGAATTCTTCTTCAGCTTCATCTGACTACCACAAATTCACACCGTCGCCGTACGGC
 
. : . : . : . : . : . :
JMFF001B07- GACGGCGTGAAGACCGGCGTGCCGGTGAGCTCGTCGTCGACGACCAGCCATGCCTACAGT
JMSF052O12- GACGGCGTGAAGACCGGCGTGCCGGTGAGCTCGTCGTCGACGACCAGCCATGCCTACAGT
rJMSF052O12+ GACGGCGTGAAGACCGGCGTGCCGGTGAGCTCGTCGTCGACGACCAGCCATGCCTACAGT
                      ____________________________________________________________
consensus GACGGCGTGAAGACCGGCGTGCCGGTGAGCTCGTCGTCGACGACCAGCCATGCCTACAGT
 
. : . : . : . : . : . :
JMFF001B07- TCCGAGGGCTCTCATATTGCGCCCAACCTGCAAGTTAAGCCTAAGATCCGCGGCCCCTGG
JMSF052O12- TCCGAGGGCTCTCATATTGCGCCCAACCTGCAAGTTAAGCCTAAGATCCGCGGCCCCTGG
rJMSF052O12+ TCCGAGGGCTCTCATATTGCGCCCAACCTGCAAGTTAAGCCTAAGATCCGCGGCCCCTGG
rJMFF001B07+ CTCTCATATTGCGCCCAACNTGCAAGTTAAGCCTAAGATCCGCGGCCCNTGG
                      ____________________________________________________________
consensus TCCGAGGGCTCTCATATTGCGCCCAACCTGCAAGTTAAGCCTAAGATCCGCGGCCCCTGG
 
. : . : . : . : . : . :
JMFF001B07- TCGACCGGCCTATGCGACTGTTTCTCTGACCCCCGTAACTGTTGTATAACTTTGTGGTGT
JMSF052O12- TCGACCGGCCTATGCGACTGTTTCTCTGACCCCCGTAACTGTTGTATAACTTTGTGGTGT
rJMSF052O12+ TCGACCGGCCTATGCGACTGTTTCTCTGACCCCCGTAACTGTTGTATAACTTTGTGGTGT
rJMFF001B07+ TCGACCGGCCTATGCGACTGTTTCTCTGACCCCCGTAACTGTTGTATAACTTTGTGGTGT
                      ____________________________________________________________
consensus TCGACCGGCCTATGCGACTGTTTCTCTGACCCCCGTAACTGTTGTATAACTTTGTGGTGT
 
. : . : . : . : . : . :
JMFF001B07- CCGTGCATCACTTTTGGACAGATTGCTGAGATTGTAGACAAGGGTTCTAATTCTTGCGGA
JMSF052O12- CCGTGCATCACTTTTGGACAGATTGCTGAGATTGTAGACAAGGGTTCTAATTCTTGCGGA
rJMSF052O12+ CCGTGCATCACTTTTGGACAGATTGCTGAGATTGTAGACAAGGGTTCTAATTCTTGCGGA
rJMFF001B07+ CCGTGCATCACTTTTGGACAGATTGCTGAGATTGTAGACAAGGGTTCTAATTCTTGCGGA
JMFN042M10+ CCGTGCATCACTTTTGGACAGATTGCTGAGATTGTAGACAAGGGTTCTAATTCTTGCGGA
                      ____________________________________________________________
consensus CCGTGCATCACTTTTGGACAGATTGCTGAGATTGTAGACAAGGGTTCTAATTCTTGCGGA
 
. : . : . : . : . : . :
JMFF001B07- GTGAATGGAGCCCTTTATACAATTTTAGCTTGTGTGACTGGTTTCCCATGCTGCTACTCA
JMSF052O12- GTGAATGGAGCCCTTTATACAATTTTAGCTTGTGTGACTGGTTTCCCATGCTGCTACTCA
rJMSF052O12+ GTGAATGGAGCCCTTTATACAATTTTAGCTTGTGTGACTGGTTTCCCATGCTGCTACTCA
rJMFF001B07+ GTGAATGGAGCCCTTTATACAATTTTAGCTTGTGTGACTGGTTTCCCATGCTGCTACTCA
JMFN042M10+ GTGAATGGAGCCCTTTATACAATTTTAGCTTGTGTGACTGGTTTCCCATGCTGCTACTCA
                      ____________________________________________________________
consensus GTGAATGGAGCCCTTTATACAATTTTAGCTTGTGTGACTGGTTTCCCATGCTGCTACTCA
 
. : . : . : . : . : . :
JMFF001B07- TGCTTCTACCGGTCAAAGATGAGGGAGCAGTACATGTTGAAGGAAACTCCCTGTGGGGAC
JMSF052O12- TGCTTCTACCGGTCAAAGATGAGGGAGCAGTACATGTTGAAGGAAACTCCCTGTGGGGAC
rJMSF052O12+ TGCTTCTACCGGTCAAAGATGAGGGAGCAGTACATGTTGAAGGAAACTCCCTGTGGGGAC
rJMFF001B07+ TGCTTCTACCGGTCAAAGATGAGGGAGCAGTACATGTTGAAGGAAACTCCCTGTGGGGAC
JMFN042M10+ TGCTTCTACCGGTCAAAGATGAGGGAGCAGTACATGTTGAAGGAAACTCCCTGTGGGGAC
                      ____________________________________________________________
consensus TGCTTCTACCGGTCAAAGATGAGGGAGCAGTACATGTTGAAGGAAACTCCCTGTGGGGAC
 
. : . : . : . : . : . :
JMFF001B07- TGTTTGGTGCATTGCTTCTGCGAGTCCTGTGCCCTCTGCCAAGAATACCGCGAGCTTA
JMSF052O12- TGTTTGGTGCATTGCTTCTGCGAGTCCTGTGCCCTCTGCCAAGAATACCGCGAGCTTAAA
rJMSF052O12+ TGTTTGGTGCATTGCTTCTGCGAGTCCTGTGCCCTCTGCCAAGAATACCGCGAGCTTAAA
rJMFF001B07+ TGTTTGGTGCATTGCTTCTGCGAGTCCTGTGCCCTCTGCCAAGAATACCGCGAGCTTAAA
JMFN042M10+ TGTTTGGTGCATTGCTTCTGCGAGTCCTGTGCCCTCTGCCAAGAATACCGCGAGCTTAAA
                      ____________________________________________________________
consensus TGTTTGGTGCATTGCTTCTGCGAGTCCTGTGCCCTCTGCCAAGAATACCGCGAGCTTAAA
 
. : . : . : . : . : . :
JMSF052O12- AACCGTGGCTTTGACATGTCTATTGGATGGCATGGAAACGTGGAAAGGCAAAATCGTGGA
rJMSF052O12+ AACCGTGGCTTTGACATGTCTATTGGATGGCATGGAAACGTGGAAAGGCAAAATCGTGGA
rJMFF001B07+ AACCGTGGCTTTGACATGTCTATTGGATGGCATGGAAACGTGGAAAGGCAAAATCGTGGA
JMFN042M10+ AACCGTGGCTTTGACATGTCTATTGGATGGCATGGAAACGTGGAAAGGCAAAATCGTGGA
                      ____________________________________________________________
consensus AACCGTGGCTTTGACATGTCTATTGGATGGCATGGAAACGTGGAAAGGCAAAATCGTGGA
 
. : . : . : . : . : . :
JMSF052O12- GTTGCCATGGCGCCATTAGTTGAAGAAGG
rJMSF052O12+ GTTGCCATGGCGCCATTAGTTGAAGAAGGGATGAGCAGATAAGAAGGCTAGTTGGGCTGC
rJMFF001B07+ GTTGCCATGGCGCCATTAGTTGAAGAAGGGATGAGCAGATAAGAAGGCTAGTTGGGCTGC
JMFN042M10+ GTTGCCATGGCGCCATTAGTTGAAGAAGGGATGAGCAGATAAGAAGGCTAGTTGGGCTGC
                      ____________________________________________________________
consensus GTTGCCATGGCGCCATTAGTTGAAGAAGGGATGAGCAGATAAGAAGGCTAGTTGGGCTGC
 
. : . : . : . : . : . :
rJMSF052O12+ CTTTTCAACTTTTGAAAATACTAAAATGCTCTTTTAAATTGGGTGTATCTTTTAAACATT
rJMFF001B07+ CTTTTCAACTTTTGAAAATACTAAAATGCTCTTTTAAATTGGGTGTATCTTTTAAACATT
JMFN042M10+ CTTTTCAACTTTTGAAAATACTAAAATGCTCTTTTAAATTGGGTGTATCTTTTAAACATT
                      ____________________________________________________________
consensus CTTTTCAACTTTTGAAAATACTAAAATGCTCTTTTAAATTGGGTGTATCTTTTAAACATT
 
. : . : . : . : . : . :
rJMSF052O12+ TTTACTTTTTGGAATGTATTTATTAATTTTACTT
rJMFF001B07+ TTTACTTTTTGGAATGTATTTATTAATTTTACTTTGTGTAAATCTTCGGATATAAATAAT
JMFN042M10+ TTTACTTTTTGGAATGTATTTATTAATTTTACTTTGTGTAAATCTTCGGATATAAATAAT
                      ____________________________________________________________
consensus TTTACTTTTTGGAATGTATTTATTAATTTTACTTTGTGTAAATCTTCGGATATAAATAAT
 
. : . : . : . : . : . :
rJMFF001B07+ TTTAATATTTACTAAAATTCGCATGC
JMFN042M10+ TTTAATATTTACTAAAATTCGCATGCXXXXXXXXXXXXXXXXXXCTCGAGACTAGTTCTC
                      ____________________________________________________________
consensus TTTAATATTTACTAAAATTCGCATGCNNNNNNNNNNNNNNNNNNCTCGAGACTAGTTCTC