Previous Contig 002761:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007F14Sequence545002761 (6)gb:AY496128_11784632e-81Capsicum annuum 60S ribosomal protein L12 mRNA, complete cds.598002761 (6)gb:AY496128_11784639e-78Capsicum annuum 60S ribosomal protein L12 mRNA, complete cds.
JMFN005B15Sequence627002761 (6)gb:AY496128_11784633e-85Capsicum annuum 60S ribosomal protein L12 mRNA, complete cds.
JMFN042J04Sequence595002761 (6)gb:AY496128_11784632e-84Capsicum annuum 60S ribosomal protein L12 mRNA, complete cds.
JMFN043O07Sequence631002761 (6)gb:AY496128_11784633e-85Capsicum annuum 60S ribosomal protein L12 mRNA, complete cds.
JMSF038N15Sequence647005080 (4)gb:BT004625_16376597e-64Arabidopsis thaliana At1g43800 gene, complete cds.666002761 (6)gb:AY496128_11784636e-85Capsicum annuum 60S ribosomal protein L12 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN043O07+ TTCAAGAGAGTTTAAGCTTTAACCTCCTAATATCGAAAGTCGTCATT
                      ____________________________________________________________
consensus TTCAAGAGAGTTTAAGCTTTAACCTCCTAATATCGAAAGTCGTCATT
 
. : . : . : . : . : . :
JMFN005B15+ GGAATCTCCACTTCTCCATCAGCGATCTCTTGCT
rJMFF007F14- GGAATCTCCACTTCTCCATCAGCGATCTCTTGCT
JMFN043O07+ TTCACTCCACCTTCTCTTAGGCTTCTGGAATCTCCACTTCTCCATCAGCGATCTCTTGCT
rJMSF038N15- CTCAGTCCTGAGGGATCTCAACGTCTCCATCAGCAATTTCCTGTT
JMFF007F14+ TCCATCAGCGATCTCTTGCT
JMFN042J04+ GGAAGCTCCACTTCTCCATCAGCGATCTCTTGCT
                      ____________________________________________________________
consensus TTCACTCCACCTTCTCTTAGTCTTGTGGAATCTCCACTTCTCCATCAGCGATCTCTTGCT
 
. : . : . : . : . : . :
JMFN005B15+ GCAAATCCTTGGGGTCCTTCCCGTCTACAGTGCACCCGACGGATACACAGGTTCCTAGGA
rJMFF007F14- GCAAATCCTTGGGGTCCTTCCCGTCTACAGTGCACCCGACGGATACACAGGTTCCTAGGA
JMFN043O07+ GCAAATCCTTGGGGTCCTTCCCGTCTACAGTGCACCCGACGGATACACAGGTTCCTAGGA
rJMSF038N15- GCAAATCCTTCGGGTCCTTGCCGTCGACGGTGCATCCAACCGATACGCAGGTCCCTAGGA
JMFF007F14+ GCAAATCCTTGGGGTCCTTCCCGTCTACAGTGCACCCGACGGATACACAGGTTCCTAGGA
JMFN042J04+ GCAAATCCTTGGGGTCCTTCCCGTCTACAGTGCACCCGACGGATACACAGGTTCCTAGGA
                      ____________________________________________________________
consensus GCAAATCCTTGGGGTCCTTCCCGTCTACAGTGCACCCGACGGATACACAGGTTCCTAGGA
 
. : . : . : . : . : . :
JMFN005B15+ TCTCCTTCACGGTGCCAGTCAAGTCCTTGGCCATGGAGCGGGGGCTCATGACCTTAGCGA
rJMFF007F14- TCTCCTTCACGGTGCCAGTCAAGTCCTTGGCCATGGAGCGGGGGCTCATGACCTTAGCGA
JMFN043O07+ TCTCCTTCACGGTGCCAGTCAAGTCCTTGGCCATGGAGCGGGGGCTCATGACCTTAGCGA
rJMSF038N15- TCTCCTTCACGGTGCCGGTCAGGTCCTTGGCCATGGAGCGAGGGCTCATGATCTTAGCAA
JMFF007F14+ TCTCCTTCACGGTGCCAGTCAAGTCCTTGGCCATGGAGCGGGGGCTCATGACCTTAGCGA
JMFN042J04+ TCTCCTTCACGGTGCCAGTCAAGTCCTTGGCCATGAAGCGGGGGCTCATGACCTTAGCGA
                      ____________________________________________________________
consensus TCTCCTTCACGGTGCCAGTCAAGTCCTTGGCCATGGAGCGGGGGCTCATGACCTTAGCGA
 
. : . : . : . : . : . :
JMFN005B15+ TCTCGATTACGTCATCGAGCGATATGTTGCCGTTGTGCTTAATGTTCTTAGTCTTCTTGC
rJMFF007F14- TCTCGATTACGTCATCGAGCGATATGTTGCCGTTGTGCTTAATGTTCTTAGTCTTCTTGC
JMFN043O07+ TCTCGATTACGTCATCGAGCGATATGTTGCCGTTGTGCTTAATGTTCTTAGTCTTCTTGC
rJMSF038N15- TCTCGATGACGTCATCCAAGGAAATGTTGCCGTTGTGTTTGATGTTCTTCGTCTTCTTCC
JMFF007F14+ TCTCGATTACGTCNTCGAGCGATATGTTGCCGTTGTGCTTAATGTTCTTAGTCTTCTTGC
JMFN042J04+ TCTCGATTACGTCATCGAGCGATATGTTGCCGTTGTGCTTAATGTTCTTAGTCTTCTTGC
                      ____________________________________________________________
consensus TCTCGATTACGTCATCGAGCGATATGTTGCCGTTGTGCTTAATGTTCTTAGTCTTCTTGC
 
. : . : . : . : . : . :
JMFN005B15+ GGTCGCGCTCGGGCTCCTTGAGCGCCTTGATGACTAGCGCGGCGGCGGAGGGGACCACCG
rJMFF007F14- GGTCGCGCTCGGGCTCCTTGAGCGCCTTGATGACTAGCGCGGCGGCGGAGGGGACCACCG
JMFN043O07+ GGTCGCGCTCGGGCTCCTTGAGCGCCTTGATGACTAGCGCGGCGGCGGAGGGGACCACCG
rJMSF038N15- GGTCACGCTCCGGCTCCTTGAGGGCCTTGATGACAAGGGCGGCGGCGGAGGGGACGACCG
JMFF007F14+ GGTCGCGCTCGGGCTCCTTGAGCGCCTTGATGACTAGCGCGGCGGCGGAGGGGACCACCG
JMFN042J04+ GGTCGCGCTCGGGCTCCTTGAGCGCCTTGATGACTAGCGCGGCGGCGGAGGGGACCACCG
                      ____________________________________________________________
consensus GGTCGCGCTCGGGCTCCTTGAGCGCCTTGATGACTAGCGCGGCGGCGGAGGGGACCACCG
 
. : . : . : . : . : . :
JMFN005B15+ ACACCTTCGCCTGACGATTCTGAACCGTAAGCTTGACGGTGACGCGGAGGCCCTTCCAGT
rJMFF007F14- ACACCTTCGCCTGACGATTCTGAACCGTAAGCTTGACGGTGACGCGGAGGCCCTTCCAGT
JMFN043O07+ ACACCTTCGCCTGACGATTCTGAACCGTAAGCTTGACGGTGACGCGGAGGCCCTTCCAGT
rJMSF038N15- CCACCTTGGCCTGACGGTTCTGAACGGTGAGCTTGACGGTGACGCGGAGGCCCTTCCAAT
JMFF007F14+ ACACCTTCGCCTGACGATTCTGAACCGTAAGCTTGACGGTGACGCGGAGGCCCTTCCAGT
JMFN042J04+ ACACCTTCGCCTGACGATTCTGAACCGTAAGCTTGACGGTGACGCGGAGGCCCTTCCAGT
                      ____________________________________________________________
consensus ACACCTTCGCCTGACGATTCTGAACCGTAAGCTTGACGGTGACGCGGAGGCCCTTCCAGT
 
. : . : . : . : . : . :
JMFN005B15+ CCTTGGCGGTCTCCTTGGCGATGTCCTCACCGATCTTCTTGGGGGAGAGACCGAGTGGAC
rJMFF007F14- CCTTGGCGGTCTCCTTGGCGATGTCCTCACCGATCTTCTTGGGGGAGAGACCGAGTGGAC
JMFN043O07+ CCTTGGCGGTCTCCTTGGCGATGTCCTCACCGATCTTCTTGGGGGAGAGACCGAGTGGAC
rJMSF038N15- CCTTGGCGGTTTCCTTGGCAATGTCCTCACCAATCTTCTTGGGGGAGAGACCGAGCGGAC
JMFF007F14+ CCTTGGCGGTCTCCTTGGCGATGTCCTCACCGATCTTCTTGGGGGAGAGACCGAGTGGAC
JMFN042J04+ CCTTGGCGGTCTCCTTGGCGATGTCCTCACCGATCTTCTTGGGGGAGAGACCGAGTGGAC
                      ____________________________________________________________
consensus CCTTGGCGGTCTCCTTGGCGATGTCCTCACCGATCTTCTTGGGGGAGAGACCGAGTGGAC
 
. : . : . : . : . : . :
JMFN005B15+ CGATCTTGGGGGCGAGAGAACTAGCCGCTCCGACTTCGCCGCCGGTGACGCGGACGAAGA
rJMFF007F14- CGATCTTGGGGGCGAGAGAACTAGCCGCTCCGACTTCGCCGCCGGTGACGCGGACGA
JMFN043O07+ CGATCTTGGGGGCGAGAGAACTAGCCGCTCCGACTTCGCCGCCGGTGACGCGGACGAAGA
rJMSF038N15- CGATCTTCGGAGCGAGAGAACTCGCGGCTCCGACCTCGCCGCCGGTGACTCTCACGAACA
JMFF007F14+ CGATCTTGGGGGCGAGAGAACTAGCCGCTCCGACTTCGCCGCCGGTGACGCGGACGAAGA
JMFN042J04+ CGATCTTGGGGGCGAGAGAACTAGCCGCTCCGACTTCGCCGCCGGTGACGCGGACGAAGA
                      ____________________________________________________________
consensus CGATCTTGGGGGCGAGAGAACTAGCCGCTCCGACTTCGCCGCCGGTGACGCGGACGAAGA
 
. : . : . : . : . : . :
JMFN005B15+ CCTCGACGACCTGTGTAGGATCGAACTTCGGCGGCATT
JMFN043O07+ CCTCGACGACCTGTGTAGGATCGAACTTCGGCGGCATT
rJMSF038N15- CCTCAACGACCTGAGTGGGATCGAACTTCGGCGGCATTTTTGCG
JMFF007F14+ CCTCGACGACCTGTGTAGGATCGAACTTCGGCGGCATT
JMFN042J04+ CCTCGACGACCTGTGTAGGATCGAACTTCGGCGGCATTTTCGCACGGAGAAGAGGGCAGA
                      ____________________________________________________________
consensus CCTCGACGACCTGTGTAGGATCGAACTTCGGCGGCATTTTTGCGCGGAGAAGAGGGCAGA