Previous Contig 002757:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN015A19Sequence618002757 (2)gb:AB024024_15157023e-65Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K15C23.>gb:BT002232_16
JMFN042F17Sequence629002757 (2)gb:AB024024_15157022e-69Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K15C23.>gb:BT002232_16

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN015A19+ TAGAGATAA
                      ____________________________________________________________
consensus TAGAGATAA
 
. : . : . : . : . : . :
JMFN015A19+ TAATTATAATTACTGCACTAATTATTAACATTATTTAATTTAATTATTATTATTGGCGAG
JMFN042F17+ ATTATTTAATTTAATTATTATTATGGGCGAG
                      ____________________________________________________________
consensus TAATTATAATTACTGCACTAATTATTAACATTATTTAATTTAATTATTATTATTGGCGAG
 
. : . : . : . : . : . :
JMFN015A19+ TTCTTTGTAGCACGGGTCCGATGGTCTTGAGTTCGAATCTTTTCACGGCTCCGGCGACGT
JMFN042F17+ TTCTTTGTAGCACGGGTCCGATGGTCTT-AGTTCGAATC-TTTCACGGCTCCGGCGACGT
                      ____________________________________________________________
consensus TTCTTTGTAGCACGGGTCCGATGGTCTTGAGTTCGAATCTTTTCACGGCTCCGGCGACGT
 
. : . : . : . : . : . :
JMFN015A19+ CACGCATCGTGGGGTCCACAACGTAGGAGATTCCGTCAACGGCGAGACGCGTGTCGTTGA
JMFN042F17+ CACGCATCGTGGGGTCCACAACGTAGGAGATTCCGTCAACGGCGAGACGCGTGTCGTTGA
                      ____________________________________________________________
consensus CACGCATCGTGGGGTCCACAACGTAGGAGATTCCGTCAACGGCGAGACGCGTGTCGTTGA
 
. : . : . : . : . : . :
JMFN015A19+ CGAGCTGGCGGCACGGCTCCCGGCGCTGGGCGATGGTGCCGTGGTAATGGTAATACATGA
JMFN042F17+ CGAGCTGGCGGCACGGCTCCCGGCGCTGGGCGATGGTGCCGTGGTAATGGTAATACATGA
                      ____________________________________________________________
consensus CGAGCTGGCGGCACGGCTCCCGGCGCTGGGCGATGGTGCCGTGGTAATGGTAATACATGA
 
. : . : . : . : . : . :
JMFN015A19+ TGCGCCCCTCCGTCTTGTGGGTGGTGTTCCCGGCGGCGTTCTCCGACATGTGGACCCCGG
JMFN042F17+ TGCGCCCCTCCGTCTTGTGGGTGGTGTTCCCGGCGGCGTTCTCCGACATGTGGACCCCGG
                      ____________________________________________________________
consensus TGCGCCCCTCCGTCTTGTGGGTGGTGTTCCCGGCGGCGTTCTCCGACATGTGGACCCCGG
 
. : . : . : . : . : . :
JMFN015A19+ TGGCGGCCACATTCCTCGGCTGCACCGCGTACTTCCGGTCCCGCCGGATCCCGGTCTTGG
JMFN042F17+ TGGCGGCCACATTCCTCGGCTGCACCGCGTACTTCCGGTCCCGCCGGATCCCGGTCTTGG
                      ____________________________________________________________
consensus TGGCGGCCACATTCCTCGGCTGCACCGCGTACTTCCGGTCCCGCCGGATCCCGGTCTTGG
 
. : . : . : . : . : . :
JMFN015A19+ AGTCCTTGAACACCAGCTTCTCGAACCCCCATTTCCGGTGAGTTTTCCCGGCGTCTTCCC
JMFN042F17+ AGTCCTTGAACACCAGCTTCTCGAACCCCCATTTCCGGTGAGTTTTCCCGGCGTCTTCCC
                      ____________________________________________________________
consensus AGTCCTTGAACACCAGCTTCTCGAACCCCCATTTCCGGTGAGTTTTCCCGGCGTCTTCCC
 
. : . : . : . : . : . :
JMFN015A19+ TGAGGCAGAGCTTATTGGACATCGGCATTTGCTCGATCGTGAACTGGGTGAAAGGGAAGA
JMFN042F17+ TGAGGCAGAGCTTATTGGACATCGGCATTTGCTCGATCGTGAACTGGGTGAAAGGGGAGA
                      ____________________________________________________________
consensus TGAGGCAGAGCTTATTGGACATCGGCATTTGCTCGATCGTGAACTGGGTGAAAGGGGAGA
 
. : . : . : . : . : . :
JMFN015A19+ GGGAATCCACGACGGATTTGAGCGTGTTTTTCTTGGGGATGAAGATGAACTCGTCGACGT
JMFN042F17+ GGGAATCCACGACGGATTTGAGCGTGTTTTTCTTGGGGATGAAGATGAACTCGTCGACGT
                      ____________________________________________________________
consensus GGGAATCCACGACGGATTTGAGCGTGTTTTTCTTGGGGATGAAGATGAACTCGTCGACGT
 
. : . : . : . : . : . :
JMFN015A19+ CGAAGAAGAACATCCATTTCGCCTGGAATTTGTATCTGTGAAGACAATCGTTTACGATTA
JMFN042F17+ CGAAGAAGAACATCCATTTCGCCTGGAATTTGTATCTGTGAAGACAATCGTTTACGATTA
                      ____________________________________________________________
consensus CGAAGAAGAACATCCATTTCGCCTGGAATTTGTATCTGTGAAGACAATCGTTTACGATTA
 
. : . : . : . : . : . :
JMFN015A19+ GGAATTGGT
JMFN042F17+ GGAATTGGTTATGGTAATACCCGTCGAATCGCTCTTCTTCCTTGACGTCTTGTAATGTGA
                      ____________________________________________________________
consensus GGAATTGGTTATGGTAATACCCGTCGAATCGCTCTTCTTCCTTGACGTCTTGTAATGTGA