Previous Contig 002756:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN041G12Sequence519002756 (2)gb:BC047761_19840070.035Homo sapiens MKL/myocardin-like 2, mRNA (cDNA clone IMAGE:5741919), complete cds
JMFN042F12Sequence176002756 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN041G12+ GAGATTACATCAGATGCCTCCTCCGCAGAGGCTCGTTACGATTGGATG
                      ____________________________________________________________
consensus GAGATTACATCAGATGCCTCCTCCGCAGAGGCTCGTTACGATTGGATG
 
. : . : . : . : . : . :
JMFN041G12+ GCTCCTGGAGTCGCTTAGTTCGTCCCGGTGCTGTGGGTTCACCTCGTTTCGGCCAAGGTC
                      ____________________________________________________________
consensus GCTCCTGGAGTCGCTTAGTTCGTCCCGGTGCTGTGGGTTCACCTCGTTTCGGCCAAGGTC
 
. : . : . : . : . : . :
JMFN041G12+ CGGGGCATGTGCGCCTAGTTGTTAGGCCTGGTGTCGCAGCGCTTTCTCGGGACAGCATGG
                      ____________________________________________________________
consensus CGGGGCATGTGCGCCTAGTTGTTAGGCCTGGTGTCGCAGCGCTTTCTCGGGACAGCATGG
 
. : . : . : . : . : . :
JMFN041G12+ GTCCCTGTTCCTCCTTGAGGTGTAGAGGACTTGTTGAGATCCCCGGTCCGTACGCAGGGG
                      ____________________________________________________________
consensus GTCCCTGTTCCTCCTTGAGGTGTAGAGGACTTGTTGAGATCCCCGGTCCGTACGCAGGGG
 
. : . : . : . : . : . :
JMFN041G12+ CGCCGTAGACCCTGTAATCCTGTTCTGGGTATACACGGCATCACAACGTCCCACACAGGT
                      ____________________________________________________________
consensus CGCCGTAGACCCTGTAATCCTGTTCTGGGTATACACGGCATCACAACGTCCCACACAGGT
 
. : . : . : . : . : . :
JMFN041G12+ TCTGGTGCCCTGGAATCAGACTTCCCGTTGGTTCCAAGTACCAAGCGTACCAAGTGCTGC
                      ____________________________________________________________
consensus TCTGGTGCCCTGGAATCAGACTTCCCGTTGGTTCCAAGTACCAAGCGTACCAAGTGCTGC
 
. : . : . : . : . : . :
JMFN041G12+ AAGGACCCCGAACCCCGAGACCAGGGGGTTCGGGGACCCCGAGACCAGGGCGCAGAGCCC
                      ____________________________________________________________
consensus AAGGACCCCGAACCCCGAGACCAGGGGGTTCGGGGACCCCGAGACCAGGGCGCAGAGCCC
 
. : . : . : . : . : . :
JMFN041G12+ AGGCCTCAGGGTGCAGAGTGCAGGGCCCAGGATCGCTTAGCAACAATATTCCGACCCACG
JMFN042F12+ TCAGGGTGCAGAGTGCAGGGGGCAGGATCGGTTAGCGACAATATTCCGACCCACG
                      ____________________________________________________________
consensus AGGCCTCAGGGTGCAGAGTGCAGGGGGCAGGATCGGTTAGCGACAATATTCCGACCCACG
 
. : . : . : . : . : . :
JMFN041G12+ CTTGGGATGGGAATTGATCCCGGGCCTTTCTTTT
JMFN042F12+ CATGAGATGGGAATCGATCCCGGGCCTTTCTTTTGAAGGTCCATAGCCGGATGCCATCAG
                      ____________________________________________________________
consensus CTTGGGATGGGAATTGATCCCGGGCCTTTCTTTTGAAGGTCCATAGCCGGATGCCATCAG