Previous Contig 002752:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN013J01Sequence546002752 (4)gb:ATAC009606_15430048e-19Arabidopsis thaliana chromosome III BAC F22F7 genomic sequence, complete sequenc
JMFN029E03Sequence318002752 (4)
JMFN041P23Sequence620002752 (4)gb:ATAC009606_15430041e-18Arabidopsis thaliana chromosome III BAC F22F7 genomic sequence, complete sequenc
JMFN044N23Sequence548002752 (4)gb:ATAC009606_15430048e-19Arabidopsis thaliana chromosome III BAC F22F7 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN013J01+ GAAATAATCTCTTTTTTTAGTGGTTAATTGATTACTTAATT
JMFN044N23+ ACTTAATT
JMFN041P23+ TTACTTAATT
                      ____________________________________________________________
consensus GAAATAATCTCTTTTTTTAGTGGTTAATTGATTACTTAATT
 
. : . : . : . : . : . :
JMFN013J01+ AAGGAGTAATATAACGACTGAGAATTAGAGGAGGAGGAGGGAGAGGATAATGAAATATAT
JMFN044N23+ AAGGAGTAATATAACGACTGAGAATTAGAGGAGGAGGAGGGAGAGGATAATGAAATATAT
JMFN041P23+ AAGGAGTAATATAACGACTGAGAATTAGAGGAGGAGGAGGGAGAGGATAATGAAATATAT
                      ____________________________________________________________
consensus AAGGAGTAATATAACGACTGAGAATTAGAGGAGGAGGAGGGAGAGGATAATGAAATATAT
 
. : . : . : . : . : . :
JMFN013J01+ CTGGAAATCTGGAATTGAATCGTCGCGGTGTTCTTCGTCTTCATCTTCATCTTCATCTTC
JMFN044N23+ CTGGAAATCTGGAATTGAATCGTCGCGGTGTTCTTCGTCTTCATCTTCATCTTCATCTTC
JMFN041P23+ CTGGAAATCTGGAATTGAATCGTCGCGGTGTTCTTCGTCTTCATCTTCATCTTCATCTTC
                      ____________________________________________________________
consensus CTGGAAATCTGGAATTGAATCGTCGCGGTGTTCTTCGTCTTCATCTTCATCTTCATCTTC
 
. : . : . : . : . : . :
JMFN013J01+ AACCTCCTCTGGCGCAATGCGTGATCATGGAGCAGCCGCGGTTGTAGGGATTGACTTTCT
JMFN044N23+ AACCTCCTCTGGCGCAATGCGTGATCATGGAGCAGCCGCGGTTGTAGGGATTGACTTTCT
JMFN041P23+ AACCTCCTCTGGCGCAATGCGTGATCATGGAGCAGCCGCGGTTGTAGGGATTGACTTTCT
                      ____________________________________________________________
consensus AACCTCCTCTGGCGCAATGCGTGATCATGGAGCAGCCGCGGTTGTAGGGATTGACTTTCT
 
. : . : . : . : . : . :
JMFN013J01+ GGTGCGTGTGGCAGTTGTAGTACGATCTGCCGCGCGCGTTGCAGGGGATGCTATTGGCGG
JMFN044N23+ GGTGCGTGTGGCAGTTGTAGTACGATCTGCCGCGCGCGTTGCAGGGGATGCTATTGGCGG
JMFN041P23+ GGTGCGTGTGGCAGTTGTAGTACGATCTGCCGCGCGCGTTGCAGGGGATGCTATTGGCGG
                      ____________________________________________________________
consensus GGTGCGTGTGGCAGTTGTAGTACGATCTGCCGCGCGCGTTGCAGGGGATGCTATTGGCGG
 
. : . : . : . : . : . :
JMFN013J01+ CCAGCGCCGCGTAGCTGATGTACTTCGTCTGCCCTAGAACTCGCCGGCTCATCCCCAACT
JMFN044N23+ CCAGCGCCGCGTAGCTGATGTACTTCGTCTGCCCTAGAACTCGCCGGCTCATCCCCAACT
JMFN029E03+ TGCCCTAGAACTCGCCGGCTCATCCCCAACT
JMFN041P23+ CCAGCGCCGCGTAGCTGATGTACTTCGTCTGCCCTAGAACTCGCCGGCTCATCCCCAACT
                      ____________________________________________________________
consensus CCAGCGCCGCGTAGCTGATGTACTTCGTCTGCCCTAGAACTCGCCGGCTCATCCCCAACT
 
. : . : . : . : . : . :
JMFN013J01+ CCATCGCCATCTCCTCGTCCTCGAACACGCAGTCGTCTCCGATCACGTTGCCGGTGCACT
JMFN044N23+ CCATCGCCATCTCCTCGTCCTCGAACACGCAGTCGTCTCCGATCACGTTGCCGGTGCACT
JMFN029E03+ CCATCGCCATCTCCTCGTCCTCGAACACGCAGTCGTCTCCGATCACGTTGCCGGTGCACT
JMFN041P23+ CCATCGCCATCTCCTCGTCCTCGAACACGCAGTCGTCTCCGATCACGTTGCCGGTGCACT
                      ____________________________________________________________
consensus CCATCGCCATCTCCTCGTCCTCGAACACGCAGTCGTCTCCGATCACGTTGCCGGTGCACT
 
. : . : . : . : . : . :
JMFN013J01+ TCCTCGGCCGGGTAGGGGTGGCGTGGTTGCCGTGCACCATCAATAGCTGCGGCTGGTGGA
JMFN044N23+ TCCTCGGCCGGGTAGGGGTGGCGTGGTTGCCGTGCACCATCAATAGCTGCGGCTGGTGGA
JMFN029E03+ TCCTCGGCCGGGTAGGGGTGGCGTGGTTGCCGTGCACCATCAATAGCTGCGGCTGGTGGA
JMFN041P23+ TCCTCGGCCGGGTAGGGGTGGCGTGGTTGCCGTGCACCATCAATAGCTGCGGCTGGTGGA
                      ____________________________________________________________
consensus TCCTCGGCCGGGTAGGGGTGGCGTGGTTGCCGTGCACCATCAATAGCTGCGGCTGGTGGA
 
. : . : . : . : . : . :
JMFN013J01+ AGCGGTGATTGTCATTGTAGGTCGGAGACGGTGGCGACGACTCTGCGACTCTAATGGATG
JMFN044N23+ AGCGGTGATTGTCATTGTAGGTCGGAGACGGTGGCGACGACTCTGCGACTCTAATGGATG
JMFN029E03+ AGCGGTGATTGTCATTGTAGGTCGGAGACGGTGGCGACGACTCTGCGACTCTAATGGATG
JMFN041P23+ AGCGGTGATTGTCATTGTAGGTCGGAGACGGTGGCGACGACTCTGCGACTCTAATGGATG
                      ____________________________________________________________
consensus AGCGGTGATTGTCATTGTAGGTCGGAGACGGTGGCGACGACTCTGCGACTCTAATGGATG
 
. : . : . : . : . : . :
JMFN013J01+ TTACGACTGATAATGTCAGAACCAC
JMFN044N23+ TTACGACTGATAATGTCAGAACCACGACGATTGACGATCGGAGATCCATTGCAGGTGATG
JMFN029E03+ TTACGACTGATAATGTCAGAACCACGACGATTGACGATCGGAGATCCATTGCAGGTGATG
JMFN041P23+ TTACGACTGATAATGTCAGAACCACGACGATTGACGATCGGAGATCCATTGCAGGTGATG
                      ____________________________________________________________
consensus TTACGACTGATAATGTCAGAACCACGACGATTGACGATCGGAGATCCATTGCAGGTGATG
 
. : . : . : . : . : . :
JMFN029E03+ GGAATGGAGAGTGCAGAAATTCAAGTAGGGTTAGCTACAAGAGTTAG
JMFN041P23+ GGAATGGAGAGTGCAGAAATTCAAGTAGGGTTAGCTACAAGAGTTAGTTATTTGACTTCA
                      ____________________________________________________________
consensus GGAATGGAGAGTGCAGAAATTCAAGTAGGGTTAGCTACAAGAGTTAGTTATTTGACTTCA