Previous Contig 002737:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN041D07Sequence617002737 (2)gb:AF272573_17822401e-84Populus x canescens clone INRA717-1-B4 14-3-3 protein (14-3-3P20-4) mRNA, comple
JMFS117F02Sequence635002737 (2)gb:AF272573_17822408e-89Populus x canescens clone INRA717-1-B4 14-3-3 protein (14-3-3P20-4) mRNA, comple

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS117F02+ AAAGGTGACAGGCCCTCTCAGAGGAATTCATAATT
JMFN041D07+ CAGAGGAATTCATAATN
                      ____________________________________________________________
consensus AAAGGTGACAGGCCCTCTCAGAGGAATTCATAATT
 
. : . : . : . : . : . :
JMFS117F02+ TCATAGTAGAAGACTGAAAAGTTCAACGCCAAGCCTAATCGTATTGNATGTGTAGGAGGC
JMFN041D07+ TCATAGTAGAAGACTGAAAAGTTCAACGCCAAGCCTAATCGTATTGGATGTGTAGGAGGC
                      ____________________________________________________________
consensus TCATAGTAGAAGACTGAAAAGTTCAACGCCAAGCCTAATCGTATTGGATGTGTAGGAGGC
 
. : . : . : . : . : . :
JMFS117F02+ AGTTCAGACTCTGCTTTAGTAGCAGCTGCCTGATATGCTTTGAGTGATTGATCAGCAGCC
JMFN041D07+ AGTTCAGACTCTGCTTTAGTAGCAGCTGCCTGATATGCTTTGAGTGATTGATCAGCAGCC
                      ____________________________________________________________
consensus AGTTCAGACTCTGCTTTAGTAGCAGCTGCCTGATATGCTTTGAGTGATTGATCAGCAGCC
 
. : . : . : . : . : . :
JMFS117F02+ TCTTTTCTTTCATCTGCCGCCTTAAACTCGGCCAAGTACCTGTAGTAATCCCCTTTCATT
JMFN041D07+ TCTTTTCTTTCATCTGCCGCCTTAAACTCGGCCAAGTACCTGTAGTAATCCCCTTTCATT
                      ____________________________________________________________
consensus TCTTTTCTTTCATCTGCCGCCTTAAACTCGGCCAAGTACCTGTAGTAATCCCCTTTCATT
 
. : . : . : . : . : . :
JMFS117F02+ TTGTAGAAAAACACTGTGGATTCACCAGTTGTACAAGAAGGAATCAAATTTCCATCTAGC
JMFN041D07+ TTGTAGAAAAACACTGTGGATTCACCAGTTGTACAAGAAGGAATCAAATTTCCATCTAGC
                      ____________________________________________________________
consensus TTGTAGAAAAACACTGTGGATTCACCAGTTGTACAAGAAGGAATCAAATTTCCATCTAGC
 
. : . : . : . : . : . :
JMFS117F02+ ACAGACATAATGTCAATACAAATGTTTGACAACTCGGTCTCAACCTTCTGTCTATAATCT
JMFN041D07+ ACAGACATAATGTCAATACAAATGTTTGACAACTCGGTCTCAAACTTCTGTCTATAATCT
                      ____________________________________________________________
consensus ACAGACATAATGTCAATACAAATGTTTGACAACTCGGTCTCAACCTTCTGTCTATAATCT
 
. : . : . : . : . : . :
JMFS117F02+ TTGATCCGCTTCACATTTTGCTCATTTCCTCTGGCTTCTTCCTTCTGTTCAATGGAAGAA
JMFN041D07+ TTGATCCGCTTCACATTTTGCTCATTTCCTCTGGCTTCTTCCTTCTGTTCAATGGAAGAA
                      ____________________________________________________________
consensus TTGATCCGCTTCACATTTTGCTCATTTCCTCTGGCTTCTTCCTTCTGTTCAATGGAAGAA
 
. : . : . : . : . : . :
JMFS117F02+ AGAATCCTCCAGGAAGCCCTTCGAGCCCCAATCACATTCTTGTACCCAACAGAGAGCAGA
JMFN041D07+ AGAATCCTCCAGGAAGCCCTTCGAGCCCCAATCACATTCTTGTACCCAACAGAGAGCAGA
                      ____________________________________________________________
consensus AGAATCCTCCAGGAAGCCCTTCGAGCCCCAATCACATTCTTGTACCCAACAGAGAGCAGA
 
. : . : . : . : . : . :
JMFS117F02+ TTCCGCTCCTCGACACTCAGCTCCACATCTAGCTTAGCTACTTTCTTCATGGAATCCACC
JMFN041D07+ TTCCGCTCCTCGACACTCAGCTCCACATCTAGCTTAGCTACTTTCTTCATGGAATCCACC
                      ____________________________________________________________
consensus TTCCGCTCCTCGACACTCAGCTCCACATCTAGCTTAGCTACTTTCTTCATGGAATCCACC
 
. : . : . : . : . : . :
JMFS117F02+ ATTTCTTCATATCGTTCGGCTTGCTCAGCGAGCTTGGCGACGTAGACGAAGGTTTCACGG
JMFN041D07+ ATTTCTTCATATCGTTCGGCTTGCTCAGCGAGCTTGGCGACGTAGACGAAGGTTTCACGG
                      ____________________________________________________________
consensus ATTTCTTCATATCGTTCGGCTTGCTCAGCGAGCTTGGCGACGTAGACGAAGGTTTCACGG
 
. : . : . : . : . : . :
JMFS117F02+ TCCTTGGAAGGTGAAGCCATTGGAGCTGCTGCTGCTAACGACGACTGATCTGAAAATGAA
JMFN041D07+ TCCTTGGAAGGTGAAGCCATTGGAGCTGCTGCTGCTAACGACGACTGATCTGAAAATGAA
                      ____________________________________________________________
consensus TCCTTGGAAGGTGAAGCCATTGGAGCTGCTGCTGCTAACGACGACTGATCTGAAAATGAA