Previous Contig 002735:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN005N21Sequence612002735 (4)pir|T03803|T038031e-50tumor-related protein, clone NF34 - common tobacco>gb:NTU66263_1691875 Nicotiana
JMFN006M02Sequence618002735 (4)pir|T03803|T038031e-50tumor-related protein, clone NF34 - common tobacco>gb:NTU66263_1691875 Nicotiana
JMFN028J12Sequence611002735 (4)pir|T03803|T038035e-50tumor-related protein, clone NF34 - common tobacco>gb:NTU66263_1691875 Nicotiana
JMFN041A16Sequence607002735 (4)pir|T03803|T038032e-47tumor-related protein, clone NF34 - common tobacco>gb:NTU66263_1691875 Nicotiana

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN005N21+ TGAATGGAACATCATCAGT
JMFN028J12+ CATCAGT
JMFN006M02+ AACATCATCAGT
JMFN041A16+ CATCAGT
                      ____________________________________________________________
consensus TGAATGGAACATCATCAGT
 
. : . : . : . : . : . :
JMFN005N21+ CAAAGCCAAAAACCTCACCCCATCCTGCTCAAAGATTCCGACATCTTTGCAGATAACCTT
JMFN028J12+ CAAAGCCAAAACCCTCACCCCATCCTGCTCAAAGATTCCGACATCTTTGCAGATAACCTT
JMFN006M02+ CAAAGCCAAAAACCTCACCCCATCCTGCTCAAAGATTCCGACATCTTTGCAGATAACCTT
JMFN041A16+ CAAAGCCAAAAACCTCACCCCATCGTGCTCAAAGATTCCGACATCTTTGCAGATATCCTT
                      ____________________________________________________________
consensus CAAAGCCAAAAACCTCACCCCATCCTGCTCAAAGATTCCGACATCTTTGCAGATAACCTT
 
. : . : . : . : . : . :
JMFN005N21+ GCAATAGTTGCACACGGTCGGACAAAACACAAACTTGTAAACGCTCTTATACTTCTGGAT
JMFN028J12+ GCAATAGTTGCACACGGTCGGACAAAACACAAACTTGTAAACGCTCTTATACTTCTGGAT
JMFN006M02+ GCAATAGTTGCACACGGTCGGACAAAACACAAACTTGTAAACGCTCTTATACTTCTGGAT
JMFN041A16+ GCAATAGTTGCTCACGGTCGGACAAAACACAAACTTGTAAACGCTCTTATACTTCTGGAT
                      ____________________________________________________________
consensus GCAATAGTTGCACACGGTCGGACAAAACACAAACTTGTAAACGCTCTTATACTTCTGGAT
 
. : . : . : . : . : . :
JMFN005N21+ CTTAAACCAACTGCTTAACGTTTGAGGGCCGGGATTTCCTTCCACCCCTCCGGTCTTCAC
JMFN028J12+ CTTAAACCAACTGCTTAACGTTTGAGGGCCGGGATTTCCTTCCACCCCTCCGGTCTTCAC
JMFN006M02+ CTTAAACCAACTGCTTAACGTTTGAGGGCCGGGATTTCCTTCCACCCCTCCGGTCTTCAC
JMFN041A16+ CTTAAACCAACTGCTTAACGTTTGAGGGCCGGGATTTCCTTCCACCCCTCCGGTCTTCAC
                      ____________________________________________________________
consensus CTTAAACCAACTGCTTAACGTTTGAGGGCCGGGATTTCCTTCCACCCCTCCGGTCTTCAC
 
. : . : . : . : . : . :
JMFN005N21+ GAAATATTTGTTCACCGACTCGTCGTAGGCGTCGACTTTCCACACCGTCTTCCTGGCGCA
JMFN028J12+ GAAATATTTGTTCACCGACTCGTCGTAGGCGTCGACTTTCCACACCGTCTTCCTGGCGCA
JMFN006M02+ GAAATATTTGTTCACCGACTCGTCGTAGGCGTCGACTTTCCACACCGTCTTCCTGGCGCA
JMFN041A16+ GAAATATTTGTTCACCGACTCGTCGTAGGCGTCGACTTTCCACACCGTCTTCCTGGCGCA
                      ____________________________________________________________
consensus GAAATATTTGTTCACCGACTCGTCGTAGGCGTCGACTTTCCACACCGTCTTCCTGGCGCA
 
. : . : . : . : . : . :
JMFN005N21+ GATGGTCGGGGTGTAGAACCTGACGTTGAGGTCAGTTGATAAGCGGACCACGCCGCCGGA
JMFN028J12+ GATGGTCGGGGTGTAGAACCTGACGTTGAGGTCAGTTGATAAGCGGACCACGCCGCCGGA
JMFN006M02+ GATGGTCGGGGTGTAGAACCTGACGTTGAGGTCAGTTGATAAGCGGACCACGCCGCCGGA
JMFN041A16+ GATGGTCGGGGTGTAGAACCTGACGTTGAGGTCAGTTGATAAGCGAACCACGCCGCCGGA
                      ____________________________________________________________
consensus GATGGTCGGGGTGTAGAACCTGACGTTGAGGTCAGTTGATAAGCGGACCACGCCGCCGGA
 
. : . : . : . : . : . :
JMFN005N21+ GGTGGCGTTGTTCACCGGCGTGAGTACCACGGGTATGCCTTTCTGGACTTCATCGGCTTC
JMFN028J12+ GGTGGCGTTGTTCACCGGCGTGAGTACCACGGGTATGCCTTTCTGGACTTCATCGGCTTC
JMFN006M02+ GGTGGCGTTGTTCACCGGCGTGAGTACCACGGGTATGCCTTTCTGGACTTCATCGGCTTC
JMFN041A16+ GGTGGCGTTGTTCACCGGCGTGAGTACCACGGGTATGCCTTTCTGGACTTCATCGGCTTC
                      ____________________________________________________________
consensus GGTGGCGTTGTTCACCGGCGTGAGTACCACGGGTATGCCTTTCTGGACTTCATCGGCTTC
 
. : . : . : . : . : . :
JMFN005N21+ CTGGATGACGTCCAGCGGGCAAATGGTCGCGTTTGATTTGATGTTGGCCGGGTATAGTCC
JMFN028J12+ CTGGATGACGTCCAGCGGGCAAATGGTCGCGTTTGATTTGATGTTGGCCGGGTATAGTCC
JMFN006M02+ CTGGATGACGTCCAGCGGGCAAATGGTCGCGTTTGATTTGATGTTGGCCGGGTATAGTCC
JMFN041A16+ CTGGATGACGTCCAGCGGGCAAATGGTCGCGTTTGATTTGATGTTGGCCGGGTATAGTCC
                      ____________________________________________________________
consensus CTGGATGACGTCCAGCGGGCAAATGGTCGCGTTTGATTTGATGTTGGCCGGGTATAGTCC
 
. : . : . : . : . : . :
JMFN005N21+ GCCGCCGTGGCCGCGGATCACCGGGAGCACGAAATAGTTTGACCCCACTTTCAGCACTTC
JMFN028J12+ GCCGCCGTGGCCGCGGATCACCGGGAGCACGAAATAGTTTGACCCCACTTTCAGCACTTC
JMFN006M02+ GCCGCCGTGGCCGCGGATCACCGGGAGCACGAAATAGTTTGACCCCACTTTCAGCACTTC
JMFN041A16+ GCCGCCGTGGCCGCGGATCACCGGGAGCACGAAATAGTTTGACCCCACTTTCAGCACTTC
                      ____________________________________________________________
consensus GCCGCCGTGGCCGCGGATCACCGGGAGCACGAAATAGTTTGACCCCACTTTCAGCACTTC
 
. : . : . : . : . : . :
JMFN005N21+ GCCCTTGGTGTCGCGGACGGGAGACGGTAGCGACGACGCGCCGGCTATCTGGTGGTGTGG
JMFN028J12+ GCCCTTGGTGTCGCGGACGGGAGACGGTAGCGACGACGCGCCGGCTATCTGGTGGTGTGG
JMFN006M02+ GCCCTTGGTGTCGCGGACGGGAGACGGTAGCGACGACGCGCCGGCTATCTGGTGGTGTGG
JMFN041A16+ GCCCTTGGTGTCGCGGACGGGAGACGGTAGCGACGACGCGCCGGCTATCTGGTGGTGTGG
                      ____________________________________________________________
consensus GCCCTTGGTGTCGCGGACGGGAGACGGTAGCGACGACGCGCCGGCTATCTGGTGGTGTGG
 
. : . : . : . : . : . :
JMFN005N21+ GAAGAAGACGAGTGAAAGCAGCAAGATCAGTAATAACGCCTTCATTATATAAA
JMFN028J12+ GAAGAAGACGAGTGAAAGCAGCAAGATCAGTAATAACGCCTTCATTATATAAA
JMFN006M02+ GAAGAAGACGAGTGAAAGCAGCAAGATCAGTAATAACGCCTTCATTATATAAA
JMFN041A16+ GAAGAAGACGAGTGAAAGCAGCAAGATCAGTAATAACGCCTTCATTATATAAAGATTGAG
                      ____________________________________________________________
consensus GAAGAAGACGAGTGAAAGCAGCAAGATCAGTAATAACGCCTTCATTATATAAAGATTGAG