Previous Contig 002730:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN040K01Sequence612002730 (2)gb:ATAC009918_15431003e-12Arabidopsis thaliana chromosome III BAC T19F11 genomic sequence, complete sequen
JMFN043J14Sequence496002730 (2)gb:ATAC009918_15431006e-32Arabidopsis thaliana chromosome III BAC T19F11 genomic sequence, complete sequen

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN043J14+ AGCGCCACTGATCTGAGAGAC
                      ____________________________________________________________
consensus AGCGCCACTGATCTGAGAGAC
 
. : . : . : . : . : . :
JMFN043J14+ TTCGGTCCTCTGAGAGGGGCTTCGCCAGAACCCGGCGCCGTAGAAGCGGTCCCACATTTC
                      ____________________________________________________________
consensus TTCGGTCCTCTGAGAGGGGCTTCGCCAGAACCCGGCGCCGTAGAAGCGGTCCCACATTTC
 
. : . : . : . : . : . :
JMFN043J14+ CTTCTCGAGCTCGACGACCTCATTGTCGGACTCAAGGGCGGCGGCCACGGCGGACGGCGA
                      ____________________________________________________________
consensus CTTCTCGAGCTCGACGACCTCATTGTCGGACTCAAGGGCGGCGGCCACGGCGGACGGCGA
 
. : . : . : . : . : . :
JMFN043J14+ GGAAATGGGGTGGATTTGGAGCTCGGAGTCGGGGCAGCTGCAGTGCCTGACGGGCCACAT
                      ____________________________________________________________
consensus GGAAATGGGGTGGATTTGGAGCTCGGAGTCGGGGCAGCTGCAGTGCCTGACGGGCCACAT
 
. : . : . : . : . : . :
JMFN043J14+ GCCGTTCTTCATCATCTTGCGGCGGCGCTTGCTGCGGATGGCCTTCCTGCAGATGCCGGC
JMFN040K01+ GCAGATGCCGGC
                      ____________________________________________________________
consensus GCCGTTCTTCATCATCTTGCGGCGGCGCTTGCTGCGGATGGCCTTCCTGCAGATGCCGGC
 
. : . : . : . : . : . :
JMFN043J14+ GGGGAGCTTGTAGACGGCGAGCACCACCAGGTTGACGAGGCCGCAGGGGCAGCAGCAGCA
JMFN040K01+ GGGGAGCTTGTAGACGGCGAGCACCACCAGGTTGACGAGGCCGCAGGGGCAGCAGCAGCA
                      ____________________________________________________________
consensus GGGGAGCTTGTAGACGGCGAGCACCACCAGGTTGACGAGGCCGCAGGGGCAGCAGCAGCA
 
. : . : . : . : . : . :
JMFN043J14+ GACGGCGGCGATGTCCGCCGTGGTCCCTCCGGCCACCTCCGCGAAGCGAGCCTTCCGGAC
JMFN040K01+ GACGGCGGCGATGTCCGCCGTGGTCCCTCCGGCCACCTCCGCGAAGCGAGCCTTCCGGAC
                      ____________________________________________________________
consensus GACGGCGGCGATGTCCGCCGTGGTCCCTCCGGCCACCTCCGCGAAGCGAGCCTTCCGGAC
 
. : . : . : . : . : . :
JMFN043J14+ GGCTTCGGGGCCGGAGGAGGAGTCCCGGGCGGGGTTCAGCAAGGGCTCCCTACCCGAGCC
JMFN040K01+ GGCTTCGGGGCCGGAGGAGGAGTCCCGGGCGGGGTTCAGCAAGGGCTCCCTACCCGAGCC
                      ____________________________________________________________
consensus GGCTTCGGGGCCGGAGGAGGAGTCCCGGGCGGGGTTCAGCAAGGGCTCCCTACCCGAGCC
 
. : . : . : . : . : . :
JMFN043J14+ CGGCGACCGGAGAGAGATCCGCTTCGTCATTATCTAAAGGGGAAGCGGAGCTGAG
JMFN040K01+ CGGCGACCGGAGAGAGATCCGCTTCGTCATTATCTAAAGGGGAAGCGGAGCTGAGATAGA
                      ____________________________________________________________
consensus CGGCGACCGGAGAGAGATCCGCTTCGTCATTATCTAAAGGGGAAGCGGAGCTGAGATAGA
 
. : . : . : . : . : . :
JMFN040K01+ TACAAATCGAAAGTAGTACGTATTAATTCCTATCCCTTAAGATAATGAAACGGAGGATCT
                      ____________________________________________________________
consensus TACAAATCGAAAGTAGTACGTATTAATTCCTATCCCTTAAGATAATGAAACGGAGGATCT
 
. : . : . : . : . : . :
JMFN040K01+ AAAAGATTGGGGAAATGAAACCGTTGGGGAAGTTGTGGTGGGGGATAAACAAAGAAACGG
                      ____________________________________________________________
consensus AAAAGATTGGGGAAATGAAACCGTTGGGGAAGTTGTGGTGGGGGATAAACAAAGAAACGG
 
. : . : . : . : . : . :
JMFN040K01+ TCTCTACGGCCGCGGATCGGAGGTAGTGTGCGACGGCGAAAGATCAAAGCTAAAAGCTAT
                      ____________________________________________________________
consensus TCTCTACGGCCGCGGATCGGAGGTAGTGTGCGACGGCGAAAGATCAAAGCTAAAAGCTAT
 
. : . : . : . : . : . :
JMFN040K01+ GGATAAAATAGAAAGTCCCAACAAAGCAACGAAATATGAGGGAGGGAACTAACCCGACCC
                      ____________________________________________________________
consensus GGATAAAATAGAAAGTCCCAACAAAGCAACGAAATATGAGGGAGGGAACTAACCCGACCC
 
. : . : . : . : . : . :
JMFN040K01+ GGATACCAGTTTTTTGTGCTTATCCGCTAATTCCTATATTTTTTTTTTGATTAAAAGTGT
                      ____________________________________________________________
consensus GGATACCAGTTTTTTGTGCTTATCCGCTAATTCCTATATTTTTTTTTTGATTAAAAGTGT
 
. : . : . : . : . : . :
JMFN040K01+ GTGGATTGTCCAAGAGAAAAAGCTATAGACCAGCAGGTTGGTGAAGGAAGAAGAAGATGA
                      ____________________________________________________________
consensus GTGGATTGTCCAAGAGAAAAAGCTATAGACCAGCAGGTTGGTGAAGGAAGAAGAAGATGA