Previous Contig 002727:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036H01Sequence379006786 (6)737002727 (6)gb:AK175752_18177405e-12Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL22-
JMFN029P19Sequence607002727 (6)pir|H96665|H966653e-41protein F22C12.10 [imported] - Arabidopsis thaliana>gb:AE005173_894073 Arabidops
JMFN040H03Sequence506002727 (6)
JMSF032B01Sequence388006786 (6)702002727 (6)gb:AK175752_18177406e-11Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL22-
JMSF036H19Sequence219006786 (6)717002727 (6)gb:AK175752_18177402e-14Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL22-
JMSF051F17Sequence386006786 (6)808002727 (6)pir|H96665|H966651e-22protein F22C12.10 [imported] - Arabidopsis thaliana>gb:AE005173_894073 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN029P19- GATTTCTGTGTGCGTCATGGT
                      ____________________________________________________________
consensus GATTTCTGTGTGCGTCATGGT
 
. : . : . : . : . : . :
JMFN029P19- GGGGGCAAGAGATGCCAGTTTGAAGGTTGTGGAAAAAGTGCTCAGGGAAGCACTGATTTT
rJMSF051F17+ GGAAGCACTGATTTT
                      ____________________________________________________________
consensus GGGGGCAAGAGATGCCAGTTTGAAGGTTGTGGAAAAAGTGCTCAGGGAAGCACTGATTTT
 
. : . : . : . : . : . :
JMFN029P19- TGCAAGGCACATGGTGGAGGGAAAAGATGCTATTGGGGCCAGCCTAGTTCTGAATTTGGC
rJMSF051F17+ TGCAAGGCACATGGNGGA-GGAAAAGATGCTATTGGGGCCAGCCTAGTTCTGAATTTGGC
                      ____________________________________________________________
consensus TGCAAGGCACATGGTGGAGGGAAAAGATGCTATTGGGGCCAGCCTAGTTCTGAATTTGGC
 
. : . : . : . : . : . :
JMFN029P19- AAAGGTGAAATTCCTTGTAATTCATTTGCCAGGGGAAAGACAGGGCTTTGTGCATCTCAT
rJMSF051F17+ AAAGGTGAAATTCCTTGTAATTCATTTGCCAGGGGAAAGACAGGGCTTTGTGCATCTCAT
rJMSF032B01+ CCAGGGGAAAGACAGGGCTTTGTGCATCTCAT
rJMSF036H19+ GGGCTTTGTGCATCTCAT
rJMFF036H01+ CATTTGCCAGGGGAAAGACAGGGCTTTGTGCATCTCAT
                      ____________________________________________________________
consensus AAAGGTGAAATTCCTTGTAATTCATTTGCCAGGGGAAAGACAGGGCTTTGTGCATCTCAT
 
. : . : . : . : . : . :
JMFN029P19- GGTGCTCTGGTTCAGGATAAACGGGTTCATGGTGGAGCTACCCTCGGAGTTGTAGTCCAG
rJMSF051F17+ GGTGCTCTGGTTCAGGATAAACGGGTTCATGGTGGAGCTACCCTCGGAGTTGTAGTCCAG
rJMSF032B01+ GGTGCTCTGGTTCAGGATAAACGGGTTCATGGTGGAGCTACCCTCGGAGTTGTAGTCCAG
rJMSF036H19+ GGTGCTCTGGTTCAGGATAAACGGGTTCATGGTGGAGCTACCCTCGGAGTTGTAGTCCAG
rJMFF036H01+ GGTGCTCTGGTTCAGGATAAACGGGTTCATGGTGGAGCTACCCTCGGAGTTGTAGTCCAG
                      ____________________________________________________________
consensus GGTGCTCTGGTTCAGGATAAACGGGTTCATGGTGGAGCTACCCTCGGAGTTGTAGTCCAG
 
. : . : . : . : . : . :
JMFN029P19- GAGATAACACCAAAGAGAACTGAGAATATGAAAGAGATTGACACTACAGAGGACATGGAT
rJMSF051F17+ GAGATAACACCAAAGAGAACTGAGAATATGAAAGAGATTGACACTACAGAGGACATGGAT
rJMSF032B01+ GAGATAACACCAAAGAGAACTGAGAATATGAAAGAGATTGACACTACAGAGGACATGGAT
rJMSF036H19+ GAGATAACACCAAAGAGAACTGAGAATATGAAAGAGATTGACACTACAGAGGACATGGAT
rJMFF036H01+ GAGATAACACCAAAGAGAACTGAGAATATGAAAGAGATTGACACTACAGAGGACATGGAT
                      ____________________________________________________________
consensus GAGATAACACCAAAGAGAACTGAGAATATGAAAGAGATTGACACTACAGAGGACATGGAT
 
. : . : . : . : . : . :
JMFN029P19- GCTGATAGCATGACTGTGGAAAGAAGTGTTGTAACATCTGCAAATGGTTCTGATTGGAAA
rJMSF051F17+ GCTGATAGCATGACTGTGGAAAGAAGTGTTGTAACATCTGCAAATGGTTCTGATTGGAAA
rJMSF032B01+ GCTGATAGCATGACTGTGGAAAGAAGTGTTGTAACATCTGCAAATGGTTCTGATTGGAAA
rJMSF036H19+ GCTGATAGCATGACTGTGGAAAGAAGTGTTGTAACATCTGCAAATGGTTCTGATTGGAAA
rJMFF036H01+ GCTGATAGCATGACTGTGGAAAGAAGTGTTGTAACATCTGCAAATGGTTCTGATTGGAAA
                      ____________________________________________________________
consensus GCTGATAGCATGACTGTGGAAAGAAGTGTTGTAACATCTGCAAATGGTTCTGATTGGAAA
 
. : . : . : . : . : . :
JMFN029P19- TATATCAGTTTTAAACAAGCTACCATGCCAATTCTAGGCAGTCCTCCATCTATTCCAGTT
rJMSF051F17+ TATATCAGTTTTAAACAAGCTACCATGCCAATTCTAGGCAGTCCTCCATCTATTCCAGTT
rJMSF032B01+ TATATCAGTTTTAAACAAGCTACCATGCCAATTCTAGGCAGTCCTCCATCTATTCCAGTT
rJMSF036H19+ TATATCAGTTTTAAACAAGCTACCATGCCAATTCTAGGCAGTCCTCCATCTATTCCAGTT
rJMFF036H01+ TATATCAGTTTTAAACAAGCTACCATGCCAATTCTAGGCAGTCCTCCATCTATTCCAGTT
JMFN040H03- CAATTCTAGGCAGTCCTCCATCTATTCCAGTT
                      ____________________________________________________________
consensus TATATCAGTTTTAAACAAGCTACCATGCCAATTCTAGGCAGTCCTCCATCTATTCCAGTT
 
. : . : . : . : . : . :
JMFN029P19- ACAATTCCTGAAGGAAGGGTTCATGGAGGAAGCTTATTGTCAATGCTAGCAAGTAATTCT
rJMSF051F17+ ACAATTCCTGAAGGAAGGGTTCATGGAGGAAGCTTATTGTCAATGCTAGCAAGTAATTCT
rJMSF032B01+ ACAATTCCTGAAGGAAGGGTTCATGGAGGAAGCTTATTGTCAATGCTAGCAAGTAATTCT
rJMSF036H19+ ACAATTCCTGAAGGAAGGGTTCATGGAGGAAGCTTATTGTCAATGCTAGCAAGTAATTCT
rJMFF036H01+ ACAATTCCTGAAGGAAGGGTTCATGGAGGAAGCTTATTGTCAATGCTAGCAAGTAATTCT
JMFN040H03- ACAATTCCTGAAGGAAGGGTTCATGGAGGAAGCTTATTGTCAATGCTAGCAAGTAATTCT
                      ____________________________________________________________
consensus ACAATTCCTGAAGGAAGGGTTCATGGAGGAAGCTTATTGTCAATGCTAGCAAGTAATTCT
 
. : . : . : . : . : . :
JMFN029P19- GACCCTTCCTTAAGCAGTAGCAGGGGCACGGAGAATCCATCTGAGCCCAGGAAAGCTTAT
rJMSF051F17+ GACCCTTCCTTAAGCAGTAGCAGGGGCACGGAGAATCCATCTGAGCCCAGGAAAGCTTAT
rJMSF032B01+ GACCCTTCCTTAAGCAGTAGCAGGGGCACGGAGAATCCATCTGAGCCCAGGAAAGCTTAT
rJMSF036H19+ GACCCTTCCTTAAGCAGTAGCAGGGGCACGGAGAATCCATCTGAGCCCAGGAAAGCTTAT
rJMFF036H01+ GACCCTTCCTTAAGCAGTAGCAGGGGCACGGAGAATCCATCTGAGCCCAGGAAAGCTTAT
JMFN040H03- GACCCTTCCTTAAGCAGTAGCAGGGGCACGGAGAATCCATCTGAGCCCAGGAAAGCTTAT
                      ____________________________________________________________
consensus GACCCTTCCTTAAGCAGTAGCAGGGGCACGGAGAATCCATCTGAGCCCAGGAAAGCTTAT
 
. : . : . : . : . : . :
JMFN029P19- ATTACACACCAAAGCTGGATGTAAGAAAGAAGACCTATCCCGCTAC
rJMSF051F17+ ATTACACACCAAAGCTGGATGTAAGAAAGAAGACCTATCCCGCTACACTTGAGGCCAGTG
rJMSF032B01+ ATTACACACCAAAGCTGGATGTAAGAAAGAAGACCTATCCCGCTACACTTGAGGCCAGTG
rJMSF036H19+ ATTACACACCAAAGCTGGATGTAAGAAAGAAGACCTATCCCGCTACACTTGAGGCCAGTG
rJMFF036H01+ ATTACACACCAAAGCTGGATGTAAGAAAGAAGACCTATCCCGCTACACTTGAGGCCAGTG
JMFN040H03- ATTACACACCAAAGCTGGATGTAAGAAAGAAGACCTATCCCGCTACACTTGAGGCCAGTG
                      ____________________________________________________________
consensus ATTACACACCAAAGCTGGATGTAAGAAAGAAGACCTATCCCGCTACACTTGAGGCCAGTG
 
. : . : . : . : . : . :
rJMSF051F17+ TGTGTATTTCCTCAATTTCCAGTTATGCAGTCTACTGAATTAATGTGTACTTGCTTTTCT
rJMSF032B01+ TGTGTATTTCCTCAATTTCCAGTTATGCAGTCTACTGAATTAATGTGTACTTGCTTTTCT
rJMSF036H19+ TGTGTATTTCCTCAATTTCCAGTTATGCAGTCTACTGAATTAATGTGTACTTGCTTTTCT
rJMFF036H01+ TGTGTATTTCCTCAATTTCCAGTTATGCAGTCTACTGAATTAATGTGTACTTGCTTTTCT
JMFN040H03- TGTGTATTTCCTCAATTTCCAGTTATGCAGTCTACTGAATTAATGTGTACTTGCTTTTCT
                      ____________________________________________________________
consensus TGTGTATTTCCTCAATTTCCAGTTATGCAGTCTACTGAATTAATGTGTACTTGCTTTTCT
 
. : . : . : . : . : . :
rJMSF051F17+ AGTTTGTTTGGTGAGGAAATGCGCTCACTTGTCAAGTGAGTGATAGAGGACTTGGCATTT
rJMSF032B01+ AGTTTGTTTGGTGAGGAAATGCGCTCACTTGTCAAGTGAGTGATAGAGGACTTGGCATTT
rJMSF036H19+ AGTTTGTTTGGTGAGGAAATGCGCTCACTTGTCAAGTGAGTGATAGAGGACTTGGCATTT
rJMFF036H01+ AGTTTGTTTGGTGAGGAAATGCGCTCACTTGTCAAGTGAGTGATAGAGGACTTGGCATTT
JMFN040H03- AGTTTGTTTGGTGAGGAAATGCGCTCACTTGTCAAGTGAGTGATAGAGGACTTGGCATTT
                      ____________________________________________________________
consensus AGTTTGTTTGGTGAGGAAATGCGCTCACTTGTCAAGTGAGTGATAGAGGACTTGGCATTT
 
. : . : . : . : . : . :
rJMSF051F17+ GATTACTATTTTGTATGTGTGGCAATAAGTATT-AACTAGGAATAGTTAGTCATA-TGAA
rJMSF032B01+ GATTACTATTTTGTATGTGTGGCAATAAGTATT-AACTAGGAATAGTTAGTCATA-TGAA
rJMSF036H19+ GATTACTATTTTGTATGTGTGGCAATAAGTATTAAACTAGGAATAGTTAGTCATACTGAA
rJMFF036H01+ GATTACTATTTTGTATGTGTGGCAATAAGTATT-AACTAGGAATAGTTAGTCATA-TGAA
JMFN040H03- GATTACTATTTTGTATGTGTGTCAATAAGTATT-AACTAGGAATAGTTAGTCATA-TGAA
                      ____________________________________________________________
consensus GATTACTATTTTGTATGTGTGGCAATAAGTATT-AACTAGGAATAGTTAGTCATA-TGAA
 
. : . : . : . : . : . :
rJMSF051F17+ TGTGGGTCATTGATATTTTCCTGTGTA-CATAGGAAAGCTTGTCCTTTGTTAGGCTTATG
rJMSF032B01+ TGTGGGTCATTGATATTTTCCTGTGTA-CATAGG-AAGCTTGTCCTTTGTTAGGCTTATG
rJMSF036H19+ TGTGGGTCATTGATATTTTCCTGTGTACCATAGG-AAGCTTGTCCTTTGTTA-GCTTATG
rJMFF036H01+ TGTGGGTCATTGATATTTTCCTGTGTA-CATAGG-AAGCTTGTCCTTTGTTA-GCTTATG
JMFN040H03- TGTGGGTCATTGATATTTTCCTGTGTA-CATAGG-AAGCTTGTCCTTTGTTA-GCTTATG
                      ____________________________________________________________
consensus TGTGGGTCATTGATATTTTCCTGTGTA-CATAGG-AAGCTTGTCCTTTGTTA-GCTTATG
 
. : . : . : . : . : . :
rJMSF051F17+ ATCCATGTGAATAT
rJMSF032B01+ ATCCATGTGAATAT
rJMSF036H19+ AT-C
rJMFF036H01+ AT-CATGTGAATATTTCATGTACTGTGACAACTAGTTAAATAAAA
JMFN040H03- AT-CATGTGAATATTTCATGTACTGTGACAACTAGTTAAATAAAACTATTGCATTGCTGT
                      ____________________________________________________________
consensus AT-CATGTGAATATTTCATGTACTGTGACAACTAGTTAAATAAAACTATTGCATTGCTGT