Previous Contig 002722:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030M23Sequence538002722 (15)gb:AC069474_15409101e-33Arabidopsis thaliana chromosome 3 BAC T2E22 genomic sequence, complete sequence.553002722 (15)gb:AY496109_11784497e-26Capsicum annuum induced stolon tip protein mRNA, complete cds.
JMFF046A23Sequence601002722 (15)gb:AC069474_15409103e-43Arabidopsis thaliana chromosome 3 BAC T2E22 genomic sequence, complete sequence.510002722 (15)gb:AY496109_11784492e-29Capsicum annuum induced stolon tip protein mRNA, complete cds.
JMFF049M07Sequence477002722 (15)gb:AC069474_15409106e-24Arabidopsis thaliana chromosome 3 BAC T2E22 genomic sequence, complete sequence.215002722 (15)
JMFN011O20Sequence613002722 (15)gb:AY496109_11784498e-30Capsicum annuum induced stolon tip protein mRNA, complete cds.
JMFN012L24Sequence615002722 (15)gb:AC069474_15409106e-36Arabidopsis thaliana chromosome 3 BAC T2E22 genomic sequence, complete sequence.
JMFN020K03Sequence604002722 (15)gb:AC069474_15409101e-44Arabidopsis thaliana chromosome 3 BAC T2E22 genomic sequence, complete sequence.
JMFN040A05Sequence629002722 (15)gb:AY496109_11784498e-30Capsicum annuum induced stolon tip protein mRNA, complete cds.
JMFN040P13Sequence489002722 (15)gb:AY496109_11784494e-30Capsicum annuum induced stolon tip protein mRNA, complete cds.
JMFN042I18Sequence628002722 (15)gb:AY496109_11784498e-30Capsicum annuum induced stolon tip protein mRNA, complete cds.
JMFN046N20Sequence563002722 (15)gb:AY496109_11784496e-30Capsicum annuum induced stolon tip protein mRNA, complete cds.
JMSF029B13Sequence638002722 (15)gb:AC069474_15409102e-42Arabidopsis thaliana chromosome 3 BAC T2E22 genomic sequence, complete sequence.692002722 (15)gb:AC069474_15409102e-37Arabidopsis thaliana chromosome 3 BAC T2E22 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF049M07- AATCTCTCTCTCCCT
JMFN020K03- TCTCTCTCCCT
                      ____________________________________________________________
consensus AATCTCTCTCTCCCT
 
. : . : . : . : . : . :
JMFF049M07- CTCTCTCTAAGGATTTCTGATTGTTTGGTAGTTTTTTTGGTTTTGAGGATGGCTCAGAAG
JMSF029B13- CAGAAG
JMFF046A23- CAGAAG
JMFF030M23- CAGAAG
JMFN020K03- CTCTCTCTAAGGATTTCTGATTGTTTGGTAGTTTTTTTGGTTTTGAGGATGGCTCAGAAG
rJMSF029B13+ AGGATGGCTCAGAAG
                      ____________________________________________________________
consensus CTCTCTCTAAGGATTTCTGATTGTTTGGTAGTTTTTTTGGTTTTGAGGATGGCTCAGAAG
 
. : . : . : . : . : . :
JMFF049M07- ACGGGGAAAGAGGAGACGGAGTTCAAGGTAGTACCTGAGACGATAACGCTTTGCGTCAAC
JMSF029B13- ACGGGGAAAGAGGAGACGGAGTTCAAGGTAGTACCTGAGACGATAACGCTTTGCGTCAAC
JMFF046A23- ACGGGGAAAGAGGAGACGGAGTTCAAGGTAGTACCTGAGACGATAACGCTTTGCGTCAAC
JMFF030M23- ACGGGGAAAGAGGAGACGGAGTTCAAGGTAGTACCTGAGACGATAACGCTTTGCGTCAAC
JMFN020K03- ACGGGGAAAGAGGAGACGGAGTTCAAGGTAGTACCTGAGACGATAACGCTTTGCGTCAAC
JMFN012L24+ GACGATAACGCTNTGCGTCAAC
rJMSF029B13+ ACGGGGAAAGAGGAGACGGAGTTCAAGGTAGTACCTGAGACGATAACGCTTTGCGTCAAC
                      ____________________________________________________________
consensus ACGGGGAAAGAGGAGACGGAGTTCAAGGTAGTACCTGAGACGATAACGCTTTGCGTCAAC
 
. : . : . : . : . : . :
JMFF049M07- AACTGCGGCGTCACCGGGAATCCGGCCGCCAATAACATGTGCCAGAAATGTTTCAGCGCC
JMSF029B13- AACTGCGGCGTCACCGGGAATCCGGCCACCAATAACATGTGCCAGAAATGTTTCAGCGCC
JMFF046A23- AACTGCGGCGTCACCGGGAATCCGGCCACCAATAACATGTGCCAGAAATGTTTCAGCGCC
JMFF030M23- AACTGCGGCGTCACCGGGAATCCGGCCACCAATAACATGTGCCAGAAATGTTTCAGCGCC
JMFN020K03- AACTGCGGCGTCACCGGGAATCCGGCCACCAATAACATGTGCCAGAAATGTTTCAGCGCC
JMFN012L24+ AACTGCGGCGTCACCGGGAATCCGGCCACCAATAACATGTGCCAGAAATGTTTCAGCGCC
rJMSF029B13+ AACTGCGGCGTCACCGGGAATCCGGCCACCAATAACATGTGCCAGAAATGTTTCAGCGCC
                      ____________________________________________________________
consensus AACTGCGGCGTCACCGGGAATCCGGCCACCAATAACATGTGCCAGAAATGTTTCAGCGCC
 
. : . : . : . : . : . :
JMFF049M07- ACCACCGCCGCCGCAGGCTCGTCGTCCGCCGCGATCCATCATAAATTCGGCGAGAAACAG
JMSF029B13- ACCACCGCCGCCGCAGGCTCGTCGTCCGCCGCGATCCATCATAAATTCGGCGAGAAACAG
JMFF046A23- ACCACCGCCGCCGCAGGCTCGTCGTCCGCCGCGATCCATCATAAATTCGGCGAGAAACAG
JMFF030M23- ACCACCGCCGCCGCAGGCTCGTCGTCCGCCGCGATCCATCATAAATTCGGCGAGAAACAG
JMFN020K03- ACCACCGCCGCCGCAGGCTCGTCGTCCGCCGCGATCCATCATAAATTCGGCGAGAAACAG
JMFN012L24+ ACCACCGCCGCCGCAGGCTCGTCGTCCGCCGCGATCCATCATAAATTCGGCGAGAAACAG
rJMSF029B13+ ACCACCGCCGCCGCAGGCTTGTNGTCCGCCGCGATCCATCATAAATTNGGCGAGAAACNG
rJMFF030M23+ CCGCGATCCATCATAAATTCGGCGAGAAACAG
JMFN011O20- CGCGATCCATCATAAATTCGGCGAGAAACAG
JMFN042I18+ CGATCCATCATAAATTCGGCGAGAAACAG
JMFN040A05+ CGATCCATCATAAATTCGGCGAGAAACAG
                      ____________________________________________________________
consensus ACCACCGCCGCCGCAGGCTCGTCGTCCGCCGCGATCCATCATAAATTCGGCGAGAAACAG
 
. : . : . : . : . : . :
JMFF049M07- CCTAGATCTGGCTTCAGGAGGTTGTCGCCGGAGAGGACGAGTCCGGATCTAAAGAGGCGA
JMSF029B13- CCTAGATCTGGCTTCAGGAGGTTGTCGCCGGAGAGGACGAGTCCGGATCTAAAGAGGCGA
JMFF046A23- CCTAGATCTGGCTTCAGGAGGTTGTCGCCGGAGAGGACGAGTCCGGATCTAAAGAGGCGA
JMFF030M23- CCTAGATCTGGCTTCAGGAGGTTGTCGCCGGAGAGGACGAGTCCGGATCTAAAGAGGCGA
JMFN020K03- CCTAGATCTGGCTTCAGGAGGTTGTCGCCGGAGAGGACGAGTCCGGATCTAAAGAGGCGA
JMFN012L24+ CCTAGATCTGGCTTCAGGAGGTTGTCGCCGGAGAGGACGAGTCCGGATCTAAAGAGGCGA
rJMSF029B13+ CCTAGATNTGGCTTCAGGAGGTTGTCGCCGGAGAGGACGAGTCCGGATNTAAAGAGGCGA
rJMFF030M23+ CCTAGATNTGGCTTCAGGAGGTTGTCNCCGGAGAGGACGAGTCCGGATTTAAAGAGGCGA
JMFN011O20- CCTAGATCTGGCTTCAGGAGGTTGTCGCCGGAGAGGACGAGTCCGTATCTAAAGAGGCGA
rJMFF046A23+ ACGAGTCCGGATCTAAAGAGGCGA
JMFN046N20+ ACGAGTCCGGATCTAAAGAGGCGA
JMFN042I18+ CCTAGATCTGGCTCCAGGAGGTTGTCGCCGGAGAGGACGAGTCCGGATCTAAAGAGGCGA
JMFN040A05+ CCTAGATCTGGCTTCAGGAGGTTGTCGCCGGAGAGGACGAGTCCGGATCTAAAGAGGCGA
                      ____________________________________________________________
consensus CCTAGATCTGGCTTCAGGAGGTTGTCGCCGGAGAGGACGAGTCCGGATCTAAAGAGGCGA
 
. : . : . : . : . : . :
JMFF049M07- GAGGATCGGACGGTTGCGCGTGGAGAGAAAACTGTCGAGGAGGAGGAGGAGGAGGAGGAG
JMSF029B13- GAGGATCGGACGGTTGCGCGTGGAGAGAAAACTGTCGAGGAGGAGGAGGAGGAGGAGGAG
JMFF046A23- GAGGATCGGACGGTTGCGCGTGGAGAGAAAACTGTCGAGGAGGAGGAGGAGGAGGAGGAG
JMFF030M23- GAGGATCGGACGGTTGCGCGTGGAGAGAAAACTGTCGAGGAGGAGGAGGAGGAGGAGGAG
JMFN020K03- GAGGATCGGACGGTTGCGCGTGGAGAGAAAACTGTCGAGGAGGAGGAGGAGGAGGAGGAG
JMFN012L24+ GAGGATCGGACGGTTGCGCGTGGAGAGAAAACTGTCGAGGAGGAGGAGGAGGAGGAGGAG
rJMSF029B13+ GAGGATNGGACGGTTGCGCGTGGAGAGAAAACTGTCGAGGAGGAGGAGGAGGAGGAGGAG
rJMFF030M23+ GAGGATCGGACGGTTGCGCGTGGAGAGAAAACTGTCGAGGAGGAGGAGGAGGAGGAGGAG
JMFN011O20- GAGGATCGGACGGTTGCGCGTGGAGAGAAAACTGTCGAGGAGGAGGAGGAGGAGGAGGAG
rJMFF046A23+ GAGGATCGGACGGTTGCGCGTGGAGAGAAAACTTTCGAGGAGGAGGAGGAGGAGGAGGAG
JMFN046N20+ GAGGATCGGACGGTTGCGCGTGGAGAGAAAACTTTCGAGGAGGAGGAGGAGGAGGAGGAG
JMFN040P13- GTTGCGCGTGGAGAGAAAACTGTCGAGGAGGAGGAGGAGGAGGAGGAG
JMFN042I18+ GAGGATCGGACGGTTGCGCGTGGAGAGAAAACTGTCGAGGAGGAGGAGGAGGAGGAGGAG
JMFN040A05+ GAGGATCGGACGGTTGCGCGTGGAGAGAAAACTGTCGAGGAGGAGGAGGAGGAGGAGGAG
                      ____________________________________________________________
consensus GAGGATCGGACGGTTGCGCGTGGAGAGAAAACTGTCGAGGAGGAGGAGGAGGAGGAGGAG
 
. : . : . : . : . : . :
JMFF049M07- AATCGGTCCCCTCCTGCTAAGAGAGAGGTGAATCGGTGCTCCGGCTGCCGGAGGAAGGTC
JMSF029B13- AATCGGTCCCCTCCTGCTAAGAGAGAGGTGAATCGGTGCTCCGGCTGCCGGAGGAAGGTC
JMFF046A23- AATCGGTCCCCTCCTGCTAAGAGAGAGGTGAATCGGTGCTCCGGCTGCCGGAGGAAGGTC
JMFF030M23- AATCGGTCCCCTCCTGCTNGGAGAGAGGTGAATCGGTGCTCCGGCTGCCGGAGGAAGGTC
JMFN020K03- AATCGGTCCCCTCCTGCTAAGAGAGAGGTGAATCGGTGCTCCGGCTGCCGGAGGAAGGTC
JMFN012L24+ AATCGGTCCCCTCCTGCTAAGAGAGAGGTGAATCGGTGCTCCGGCTGCCGGAGGAAGGTC
rJMSF029B13+ AATCGGTCCCCTCCTGCTAAGAGAGAGGTGAATCGGTGCTCCGGCTGCCGGAGGAAGGTC
rJMFF030M23+ AATCGGTCCCCTCCTGNTAAGAGAGAGGTGAATCGGTGCTCCGGCTGCCGGAGGAAGGTN
JMFN011O20- AATCGGTCCCCTCCTGCTAAGAGAGAGGTGAATCGGTGCTCCGGCTGCCGGAGGAAGGTC
rJMFF046A23+ AATCGGTCCCCTCCTGCTAAGAGAGAGGTGAATCGGTGCTCCGGCTGCCGGACGAAGGTC
JMFN046N20+ AATCGGTCCCCTCCTGCTAAGAGAGAGGTGAATCGGTGCTCCGGCTGCCGGAGGAAGGTC
JMFN040P13- AATCGGTCCCCTCCTGCTAAGAGAGAGGTGAATCGGTGCTCCGGCTGCCGGAGGAAGGTC
JMFN042I18+ AATCGGTCCCCTCCTGCTAAGAGAGAGGTGAATCGGTGCTCCGGCTGCCGGAGGAAGGTC
JMFN040A05+ AATCGGTCCCCTCCTGCTAAGAGAGAGGTGAATCGGTGCTCCGGCTGCCGGAGGAAGGTC
                      ____________________________________________________________
consensus AATCGGTCCCCTCCTGCTAAGAGAGAGGTGAATCGGTGCTCCGGCTGCCGGAGGAAGGTC
 
. : . : . : . : . : . :
JMFF049M07- GGATTGACGGGATTCCGGTGCCGATGTGGCGAGCTCTTCTGC
JMSF029B13- GGATTGACGGGATTCCGGTGCCGATGTGGCGAGCTCTTCTGCGGCGAGCACCGGTATTCC
JMFF046A23- GGATTGACGGGATTCCGGTGCCGATGTGGCGAGCTCTTCTGCGGCGAGCACCGGTATTCC
JMFF030M23- GGATTGACGGGATTCCGGTGCCGATGTGGCGAGCTCTTCTGCGGCGAGCACCGGTATTCC
JMFN020K03- GGATTGACGGGATTCCGGTGCCGATGTGGCGAGCTCTTCTGCGGCGAGCACCGGTATTCC
JMFN012L24+ GGATTGACGGGATTCCGGTGCCGATGTGGCGAGCTCTTCTGCGGCGAGCACCGGTATTCC
rJMSF029B13+ GGATTGACGGGATTCCGGTGCCGATGTGGCGAGCTNTTTTGCGGCGAGCNCCGGTATTCC
rJMFF030M23+ GGATTGACGGGATTCCGGTGCCGATGTGGCGAGCTTTTTTGCGGNGAGCCCCGGTATTCC
JMFN011O20- GGATTGACGGGATTCCGGTGCCGATGTGGCGAGCTCTTCTGCGGCGAGCACCGGTATTCC
rJMFF046A23+ GGATTGACGGGATTCCGGTGCCGATGTGGCGAGCTCTTCTGCGGCGAGCACCGGTATTCC
JMFN046N20+ GGATTGACGGGATTCCGGTGCCGATGTGGCGAGCTCTTCTGCGGCGAGCACCGGTATTCC
JMFN040P13- GGATTGACGGGATTCCGGTGCCGATGTGGCGAGCTCTTCTGCGGCGAGCACCGGTATTCC
JMFN042I18+ GGATTGACGGGATTCCGGTGCCGATGTGGCGAGCTCTTCTGCGGCGAGCACCGGTATTCC
JMFN040A05+ GGATTGACGGGATTCCGGTGCCGATGTGGCGAGCTCTTCTGCGGCGAGCACCGGTATTCC
                      ____________________________________________________________
consensus GGATTGACGGGATTCCGGTGCCGATGTGGCGAGCTCTTCTGCGGCGAGCACCGGTATTCC
 
. : . : . : . : . : . :
JMSF029B13- GACCGACACGACTGCAGCTACGACTACAAAGCCGCCGGCCGAGACGCGATCGCGAGGGAG
JMFF046A23- GACCGACACGACTGCAGCTACGACTACNAAGCCGCCGGCCGAGACGCGATCGCGAGGGAG
JMFF030M23- GACCGACACGACTGCAGCTACGACTA
JMFN020K03- GACCGACACGACTGCAGCTACGACTACAAAGCCGCCGGCCGAGACGCGATCGCGAGGGAG
JMFN012L24+ GACCGACACGACTGCAGCTACGACTACAAAGCCGCCGGCCGAGACGCGATCGCGAGGGAG
rJMSF029B13+ GACCGACNCGACTGCAGCTACGACTACAAAGCCNCCGGCCGAGACGCGATCGCGAGGGAG
rJMFF030M23+ GACCGACNCGACTGCAGCTNCGACTACAAAGCCNCCGGCCGAGACGCGATCGCGAGGGAG
JMFN011O20- GACCGACACGACTGCAGCTACGACTACAAAGCCGCCGGCCGAGACGCGATCGCGAGGGAG
rJMFF046A23+ GACCGACACGACTGCAGCTACGACTACAAAGCCGCCGGCCGAGACGCGATCGCGAGGGAG
JMFN046N20+ GACCGACACGACTGCAGCTACGACTACAAAGCCGCCGGCCGAGACGCGATCGCGAGGGAG
JMFN040P13- GACCGACACGACTGCAGCTACGACTACAAAGCCGCCGGCCGAGACGCGATCGCGAGGGAG
JMFN042I18+ GACCGACACGACTGCAGCTACGACTACAAAGCCGCCGGCCGAGACGCGATCGCGAGGGAG
JMFN040A05+ GACCGACACGACTGCAGCTACGACTACAAAGCCGCCGGCCGAGACGCGATCGCGAGGGAG
                      ____________________________________________________________
consensus GACCGACACGACTGCAGCTACGACTACAAAGCCGCCGGCCGAGACGCGATCGCGAGGGAG
 
. : . : . : . : . : . :
JMSF029B13- AATCCCGTCGTGAAGG
JMFF046A23- AATCCCGTCGTGAAGGCCGCAAAA
JMFN020K03- AATCCCGTCGTGAAGGGCCGCAAAATCGTTAAGGTTTGAACGTGACGAGACGT
JMFN012L24+ AATCCCGTCGTGAAGGCCGCAAAAATCGTTAAGGTTTGAACGTGACGAGACGTATAAAAT
rJMSF029B13+ AATCCCGTCGTGAAGGCCGCAAAAATCGTTAAGGTTTGAACGTGACGAGACGTATAAAAT
rJMFF030M23+ AATCCCGTCGTGAAGGCCGCAAAAATCGTTAAGGTTTGAACGTGACGAGACGTATAAAAT
JMFN011O20- AATCCCGTCGTGAAGGCCGCAAAAATCGTTAAGGTTTGAACGTGACGAGACGTATAAAAT
rJMFF046A23+ AATCCCGTCGTGAAGGCCGCAAAAATCGTTAAGGTTTGAACGTGACGAGACGTATAAAAT
JMFN046N20+ AATCCCGTCGTGAAGGCCGCAAAAATCGTTAAGGTTTGAACGTGACGAGACGTATAAAAT
JMFN040P13- AATCCCGTCGTGAAGGCCGCAAAAATCGTTAAGGTTTGAACGTGACGAGACGTATAAAAT
JMFN042I18+ AATCCCGTCGTGAAGGCCGCAAAAATCGTTAAGGTTTGAACGTGACGAGACGTATAAAAT
JMFN040A05+ AATCCCGTCGTGAAGGCCGCAAAAATCGTTAAGGTTTGAACGTGACGAGACGTATAAAAT
                      ____________________________________________________________
consensus AATCCCGTCGTGAAGGCCGCAAAAATCGTTAAGGTTTGAACGTGACGAGACGTATAAAAT
 
. : . : . : . : . : . :
JMFN012L24+ ACGCACATCAAAACGGAAAAAGGATCGGTCGACGCTCTCTTCGATCTCTGCAGCTCATAT
rJMSF029B13+ ACGCNCNTCAAAACGGAAAAAGGATCGGTNGACGCTCTNTTCGATCTNTGCAGCTCATAT
rJMFF030M23+ ACGCNCATCAAAACGGAAAAAGGATCGGTNGACGCTNTTTTCGATNTNTGCAGCTCATAT
JMFN011O20- ACGCACATCAAAACGGAAAAAGGATCGGTCGACGCTCTCTTCGATCTTTGCAGCTCATAT
rJMFF046A23+ ACGCACATCAAAACGGAAAAAGGATCGGTCGACGCTCTCTTCGATCTCTGCAGCTCATAT
JMFN046N20+ ACGCACATCAAAACGGAAAAAGGATCGGTCGACGCTCTCTTCGATCTCTGCAGCTCATAT
JMFN040P13- ACGCACATCAAAACGGAAAAAGGATCGGTCGACGCTCTCTTCGATCTCTGCAGCTCATAT
JMFN042I18+ ACGCACATCAAAACGGAAAAAGGATCGGTCGACGCTCTCTTCGATCTCTGCAGCTCATAT
rJMFF049M07+ AAAGGATCGGTCGACGCTCTCTTCGATCTCTGCAGCTCATAT
JMFN040A05+ ACGCACATCAAAACGGAAAAAGGATCGGTCGACGCTCTCTTCGATCTCTGCAGCTCATAT
                      ____________________________________________________________
consensus ACGCACATCAAAACGGAAAAAGGATCGGTCGACGCTCTCTTCGATCTCTGCAGCTCATAT
 
. : . : . : . : . : . :
JMFN012L24+ CGT-TCTTCTTGTCTGTTAT
rJMSF029B13+ CGT-TNTTCTTGTCTGTTATAAACAAAAAAAAAAATCGGATAAAAGATGGTCGAAGAAAA
rJMFF030M23+ CGT-TNTTNTTGTCTGTTATAAACAAAAAAAAAAATCGGATAAAAGATGGTCGAAGAAAA
JMFN011O20- CGT-TCTTCTTGTCTGTTATAAACAAAAAAAAAAATCGGATAAAAGATGGTCGAAGAAAA
rJMFF046A23+ CGT-TCTTCTTGTCTGTTATAAACAAAAAAAAAAATCGGATAAAAGATGGTCGAAGAAAA
JMFN046N20+ CGT-TCTTCTTGTCTGTTATAAACAAAAAAAAAAATCGGATAAAAGATGGTCGAAGAAAA
JMFN040P13- CGT-TCTTCTTGTCTGTTATAAACAAAAAAAAAAATCGGATAAAAGATGGTCGAAGAAAA
JMFN042I18+ CGT-TCTTCTTGTCTGTTATAAACAAAAAAAAAAATCGGATAAAAGATGGTCGAAGAAAA
rJMFF049M07+ CGT-TCTTCTGGTCTGTTATAACCAAAAAAAAAAATCGGATAAAAGATGGTCGAAGAAAA
JMFN040A05+ CGTCTCTTCTTGTCTGTTATAAACAAAAAAAAAAATCGGATAAAAGATGGTCGAAGAAAA
                      ____________________________________________________________
consensus CGT-TCTTCTTGTCTGTTATAAACAAAAAAAAAAATCGGATAAAAGATGGTCGAAGAAAA
 
. : . : . : . : . : . :
rJMSF029B13+ CTTCGCTACGATTAATAT
rJMFF030M23+ CTTCGCTACGATTAATATTGTTTTCTGATTTGATCTTAAGGA
JMFN011O20- CTTCGCTACGATTAATATTGTTTTCTGATTTGATCTTAAGGATTGTAGCTTTACGATTCC
rJMFF046A23+ CTTCGCTACGATTAATATTGTTTTCTGATTTGATCTTAAGGATTGTAGCTTTACGATTCC
JMFN046N20+ CTTCGCTACGATTAATATTGTTTTCTGATTTGATCTTAAGGATTGTAGCTTTACGATTCC
JMFN040P13- CTTCGCTACGATTAATATTGTTTTCTGATTTGATCTTAAGGATTGTAGCTTTACGATTCC
JMFN042I18+ CTTCGCTACGATTAATATTGTTTTCTGATTTGATCTTAAGGATTGTAGCTTTACGATTCC
rJMFF049M07+ CTTCGCTACGATTAATATTGTTTTCTGATTTGATCTTAAGGATTGTAGCTTTACGATTCC
JMFN040A05+ CTTCGCTACGATTAATATTGTTTTCTGATTTGATCTTAAGGATTGTAGCTTTACGATTCC
                      ____________________________________________________________
consensus CTTCGCTACGATTAATATTGTTTTCTGATTTGATCTTAAGGATTGTAGCTTTACGATTCC
 
. : . : . : . : . : . :
JMFN011O20- TAATTAGAATTTCATAGATTTT
rJMFF046A23+ TAATTAG
JMFN046N20+ TAATTAGAATTTCATAGATTTT
JMFN040P13- TAATTAGAATTTCATAGATTTT
JMFN042I18+ TAATTAGAATTTCATAGATTTT
rJMFF049M07+ TAATTAGAATTTCATAGATTTT
JMFN040A05+ TAATTAGAATTTCATAGATTTTXXXXXXXXXXXXXXXXXXCTCGAGACTAGTTCTCTCTC
                      ____________________________________________________________
consensus TAATTAGAATTTCATAGATTTTNNNNNNNNNNNNNNNNNNCTCGAGACTAGTTCTCTCTC