Previous Contig 002720:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN039N22Sequence646002720 (2)gb:AY533017_16121441e-36Capsicum annuum proline-rich protein 1 (PRP1) mRNA, complete cds.
JMFS154C02Sequence629002720 (2)gb:AY533017_16121441e-36Capsicum annuum proline-rich protein 1 (PRP1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS154C02+ TTAAAATGCTATGAGACAATCGACAATAAACACAATAATGAAGTTTTTT
                      ____________________________________________________________
consensus TTAAAATGCTATGAGACAATCGACAATAAACACAATAATGAAGTTTTTT
 
. : . : . : . : . : . :
JMFS154C02+ TTTTTTTTTTTTGTTTTAATTTTTTATTTTACCAAAAGATAGTAAAAACCAGCAGGCTGG
JMFN039N22+ TTTTTATTNTACCAAAAGATAGTAAAAACCAGCAGGCTGG
                      ____________________________________________________________
consensus TTTTTTTTTTTTGTTTTAATTTTTTATTTTACCAAAAGATAGTAAAAACCAGCAGGCTGG
 
. : . : . : . : . : . :
JMFS154C02+ GCAGAAATTGACTAATCTTCAACGCGGGCAGGGAGCCTTCTTGGACGGCTCAAAAGCGAA
JMFN039N22+ GCAGAAATTGACTAATCTTCAACGCGGGCAGGGAGCCTTCTTGGACGGCTCAAAAGCGAA
                      ____________________________________________________________
consensus GCAGAAATTGACTAATCTTCAACGCGGGCAGGGAGCCTTCTTGGACGGCTCAAAAGCGAA
 
. : . : . : . : . : . :
JMFS154C02+ TGGACCGACGGTGAAGAGCTGGTACGGCGGCGATTTGAGCTCCGGCGGTGGTGGGGTGGG
JMFN039N22+ TGGACCGACGGTGAAGAGCTGGTACGGCGGCGATTTGAGCTCCGGCGGTGGTGGGGTGGG
                      ____________________________________________________________
consensus TGGACCGACGGTGAAGAGCTGGTACGGCGGCGATTTGAGCTCCGGCGGTGGTGGGGTGGG
 
. : . : . : . : . : . :
JMFS154C02+ GATCAAGGGGGCTCCGGCTTGCCCAAGTTTGTAGTTTGTGAACACACTGCACTCCGGCTT
JMFN039N22+ GATCAAGGGGGCTCCGGCTTGCCCAAGTTTGTAGTTTGTGAACACACTGCACTCCGGCTT
                      ____________________________________________________________
consensus GATCAAGGGGGCTCCGGCTTGCCCAAGTTTGTAGTTTGTGAACACACTGCACTCCGGCTT
 
. : . : . : . : . : . :
JMFS154C02+ GGGAGACGCCACCAAAAACACCTTGCATTTATGGAACCCGGCGGAGGTGACAGTCTTGGG
JMFN039N22+ GGGAGACGCCACCAAAAACACCTTGCATTTATGGAACCCGGCGGAGGTGACAGTCTTGGG
                      ____________________________________________________________
consensus GGGAGACGCCACCAAAAACACCTTGCATTTATGGAACCCGGCGGAGGTGACAGTCTTGGG
 
. : . : . : . : . : . :
JMFS154C02+ CATGATCAAGAAGAACCCATTCTTGTCTGTCTTGGCTTTCTCTACCAGATGATACTTTGT
JMFN039N22+ CATGATCAAGAAGAACCCATTCTTGTCTGTCTTGGCTTTCTCTACCAGATGATACTTTGT
                      ____________________________________________________________
consensus CATGATCAAGAAGAACCCATTCTTGTCTGTCTTGGCTTTCTCTACCAGATGATACTTTGT
 
. : . : . : . : . : . :
JMFS154C02+ GTTGTTGCATGCTAGCTTCACCACAGCTCCTTCGAGGGGAGTGGCTTTGTAGAGGTTATC
JMFN039N22+ GTTGTTGCATGCTAGCTTCACCACAGCTCCTTCGAGGGGAGTGGCTTTGTAGAGGTTATC
                      ____________________________________________________________
consensus GTTGTTGCATGCTAGCTTCACCACAGCTCCTTCGAGGGGAGTGGCTTTGTAGAGGTTATC
 
. : . : . : . : . : . :
JMFS154C02+ GACGCCCCTGTACTGGCAAGATTTGCAGTAAACGAGGCCACGGACAGCTATGGCTTTCCG
JMFN039N22+ GACGCCCCTGTACTGGCAAGATTTGCAGTAAACGAGGCCACGGACAGCTATGGCTTTCCG
                      ____________________________________________________________
consensus GACGCCCCTGTACTGGCAAGATTTGCAGTAAACGAGGCCACGGACAGCTATGGCTTTCCG
 
. : . : . : . : . : . :
JMFS154C02+ TTGAACCGGGGGAGATGGGGTGGGAGGTTTGACCGGCGGGGGAATGGGGGCGGCCGGAGG
JMFN039N22+ TTGAACCGGGGGAGATGGGGTGGGAGGTTTGACCGGCGGGGGAATGGGGGCGGCCGGAGG
                      ____________________________________________________________
consensus TTGAACCGGGGGAGATGGGGTGGGAGGTTTGACCGGCGGGGGAATGGGGGCGGCCGGAGG
 
. : . : . : . : . : . :
JMFS154C02+ CTTTGGGGAATGGTGGTG
JMFN039N22+ CTTTGGGGAATGGTGGTGCCAATGCCCAACTCACAGCGCCACCATTTTCATGGCCAAGAA
                      ____________________________________________________________
consensus CTTTGGGGAATGGTGGTGCCAATGCCCAACTCACAGCGCCACCATTTTCATGGCCAAGAA
 
. : . : . : . : . : . :
JMFN039N22+ CTGAGAATGAGCTAAGAAAAACAAGTAAGAGATGTATGAAGATGAAGGGTTTGGCTTGGA
                      ____________________________________________________________
consensus CTGAGAATGAGCTAAGAAAAACAAGTAAGAGATGTATGAAGATGAAGGGTTTGGCTTGGA