Previous Contig 002710:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN008B02Sequence625002710 (3)gb:AY626826_16185341e-42Oryza sativa (japonica cultivar-group) cell death-related protein (A2) mRNA, com
JMFN014O16Sequence574002710 (3)gb:AY626826_16185349e-43Oryza sativa (japonica cultivar-group) cell death-related protein (A2) mRNA, com
JMFN039A04Sequence629002710 (3)gb:AY626826_16185341e-42Oryza sativa (japonica cultivar-group) cell death-related protein (A2) mRNA, com

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN014O16+ ACAAAAACTGATGATTTAGCATTGTGCTAACAAAGT
JMFN008B02+ TGATGATTTAGCATTGTGCTAACANAGT
JMFN039A04+ TGATGATTTAGCATTGTGCTAACAAAGT
                      ____________________________________________________________
consensus ACAAAAACTGATGATTTAGCATTGTGCTAACAAAGT
 
. : . : . : . : . : . :
JMFN014O16+ CAGACAACACACAAGTACATAAGCAAATAGGCATTAACCACAAGCTGGTTTCTCATGTAG
JMFN008B02+ CAGACAACACACAAGTACATAAGCAAATAGGCATTAACCACAAGCTGGTTTCTCATGTAG
JMFN039A04+ CAGACAACACACAAGTACATAAGCAAATAGGCATTAACCACAAGCTGGTTTCTCATGTAG
                      ____________________________________________________________
consensus CAGACAACACACAAGTACATAAGCAAATAGGCATTAACCACAAGCTGGTTTCTCATGTAG
 
. : . : . : . : . : . :
JMFN014O16+ ATACAAGCAAGTACTACTATATATAATCAATACTCAAAACAGGAAGCATGGACCTAATCA
JMFN008B02+ ATACAAGCAAGTACTACTATATATAATCAATACTCAAAACAGGAAGCATGGACCTAATCA
JMFN039A04+ ATACAAGCAAGTACTACTATATATAATCAATACTCAAAACAGGAAGCATGGACCTAATCA
                      ____________________________________________________________
consensus ATACAAGCAAGTACTACTATATATAATCAATACTCAAAACAGGAAGCATGGACCTAATCA
 
. : . : . : . : . : . :
JMFN014O16+ TCGTCCTCGAGAACGTTGCGACGCCTCTGGATCGTTACTTTTGTTTGTTTGGTGGTTTGA
JMFN008B02+ TCGTCCTCGAGAACGTTGCGACGCCTCTGGATCGTTACTTTTGTTTGTTTGGTGGTTTGA
JMFN039A04+ TCGTCCTCGAGAACGTTGCGACGCCTCTGGATCGTTACTTTTGTTTGTTTGGTGGTTTGA
                      ____________________________________________________________
consensus TCGTCCTCGAGAACGTTGCGACGCCTCTGGATCGTTACTTTTGTTTGTTTGGTGGTTTGA
 
. : . : . : . : . : . :
JMFN014O16+ GTGTTGATCTGTTCAAGCAATTGTATCAGCTTTTCTTCAGACACCTTCTCAGTAATCTGG
JMFN008B02+ GTGTTGATCTGTTCAAGCAATTGTATCAGCTTTTCTTCAGACACCTTCTCAGTAATCTGG
JMFN039A04+ GTGTTGATCTGTTCAAGCAATTGTATCAGCTTTTCTTCAGACACCTTCTCAGTAATCTGG
                      ____________________________________________________________
consensus GTGTTGATCTGTTCAAGCAATTGTATCAGCTTTTCTTCAGACACCTTCTCAGTAATCTGG
 
. : . : . : . : . : . :
JMFN014O16+ CCAAATTGAGCAGCTCTGAGTATAACATCTTCAACTCCTCTGGCCTTTTCGGGCTTCACT
JMFN008B02+ CCAAATTGAGCAGCTCTGAGTATAACATCTTCAACTCCTCTGGCCTTTTCGGGCTTCACT
JMFN039A04+ CCAAATTGAGCAGCTCTGAGTATAACATCTTCAACTCCTCTGGCCTTTTCGGGCTTCACT
                      ____________________________________________________________
consensus CCAAATTGAGCAGCTCTGAGTATAACATCTTCAACTCCTCTGGCCTTTTCGGGCTTCACT
 
. : . : . : . : . : . :
JMFN014O16+ AGTGCAATTCGGGCAACTCTTTCTCTTGCTTGAGAAGTGAGAAGCTGACTAAGCATCATT
JMFN008B02+ AGTGCAATTCGGGCAACTCTTTCTCTTGCTTGAGAAGTGAGAAGCTGACTAAGCATCATT
JMFN039A04+ AGTGCAATTCGGGCAACTCTTTCTCTTGCTTGAGAAGTGAGAAGCTGACTAAGCATCATT
                      ____________________________________________________________
consensus AGTGCAATTCGGGCAACTCTTTCTCTTGCTTGAGAAGTGAGAAGCTGACTAAGCATCATT
 
. : . : . : . : . : . :
JMFN014O16+ TGCCTTCGATCCTCGGCCTCCCTTTTAGCTTCATCTTGAGCCTTTTGTTGATCAGGGTTT
JMFN008B02+ TGCCTTCGATCCTCGGCCTCCCTTTTAGCTTCATCTTGAGCCTTTTGTTGATCAGGGTTT
JMFN039A04+ TGCCTTCGATCCTCGGCCTCCCTTTTAGCTTCATCTTGAGCCTTTTGTTGATCAGGGTTT
                      ____________________________________________________________
consensus TGCCTTCGATCCTCGGCCTCCCTTTTAGCTTCATCTTGAGCCTTTTGTTGATCAGGGTTT
 
. : . : . : . : . : . :
JMFN014O16+ TGATTATTTCCAGCCCCATGTTGAGCCATCAGCTCCTGCATTCTCCTTTGCCGGATAGCT
JMFN008B02+ TGATTATTTCCAGCCCCATGTTGAGCCATCAGCTCCTGCATTCTCCTTTGCCGGATAGCT
JMFN039A04+ TGATTATTTCCAGCCCCATGTTGAGCCATCAGCTCCTGCATTCTCCTTTGCCGGATAGCT
                      ____________________________________________________________
consensus TGATTATTTCCAGCCCCATGTTGAGCCATCAGCTCCTGCATTCTCCTTTGCCGGATAGCT
 
. : . : . : . : . : . :
JMFN014O16+ TCTAATTCAGGGTCAGCCATTAATCTGTGCAGAATTGGATCGAGGAGCGCGGAGGAGA
JMFN008B02+ TCTAATTCAGGGTCAGCCATTAATCTGTGCAGAATTGGATCGAGGAGCGCGGAGGAGAGG
JMFN039A04+ TCTAATTCAGGGTCAGCCATTAATCTGTGCAGAATTGGATCGAGGAGCGCGGAGGAGAGG
                      ____________________________________________________________
consensus TCTAATTCAGGGTCAGCCATTAATCTGTGCAGAATTGGATCGAGGAGCGCGGAGGAGAGG
 
. : . : . : . : . : . :
JMFN008B02+ AAATCGAAGAGCAAAAAGCAGCGTTTCAAGAACGCGATTGAAGAGTGGGAGTGGTGG
JMFN039A04+ AAATCGAAGAGCAAAAAGCAGCGTTTCAAGAACGCGATTGAAGAGTGGGAGTGGTGGCAC
                      ____________________________________________________________
consensus AAATCGAAGAGCAAAAAGCAGCGTTTCAAGAACGCGATTGAAGAGTGGGAGTGGTGGCAC