Previous Contig 002708:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043P24Sequence640002708 (11)sp|Q9ZUX4|UMP2_ARATH3e-27Unknown mitochondrial protein At2g27730.>pir|C84676|C84676 hypothetical protein 556002708 (11)sp|Q9ZUX4|UMP2_ARATH8e-27Unknown mitochondrial protein At2g27730.>pir|C84676|C84676 hypothetical protein
JMFN005F24Sequence627002708 (11)sp|Q9ZUX4|UMP2_ARATH3e-27Unknown mitochondrial protein At2g27730.>pir|C84676|C84676 hypothetical protein
JMFN006J13Sequence623002708 (11)sp|Q9ZUX4|UMP2_ARATH3e-27Unknown mitochondrial protein At2g27730.>pir|C84676|C84676 hypothetical protein
JMFN014M10Sequence617002708 (11)sp|Q9ZUX4|UMP2_ARATH8e-27Unknown mitochondrial protein At2g27730.>pir|C84676|C84676 hypothetical protein
JMFN014P22Sequence628002708 (11)sp|Q9ZUX4|UMP2_ARATH3e-27Unknown mitochondrial protein At2g27730.>pir|C84676|C84676 hypothetical protein
JMFN017G11Sequence613002708 (11)sp|Q9ZUX4|UMP2_ARATH3e-27Unknown mitochondrial protein At2g27730.>pir|C84676|C84676 hypothetical protein
JMFN031G05Sequence607002708 (11)sp|Q9ZUX4|UMP2_ARATH3e-27Unknown mitochondrial protein At2g27730.>pir|C84676|C84676 hypothetical protein
JMFN037A10Sequence643002708 (11)sp|Q9ZUX4|UMP2_ARATH3e-27Unknown mitochondrial protein At2g27730.>pir|C84676|C84676 hypothetical protein
JMFN037D13Sequence629002708 (11)sp|Q9ZUX4|UMP2_ARATH2e-27Unknown mitochondrial protein At2g27730.>pir|C84676|C84676 hypothetical protein
JMFN038O23Sequence630002708 (11)sp|Q9ZUX4|UMP2_ARATH4e-27Unknown mitochondrial protein At2g27730.>pir|C84676|C84676 hypothetical protein

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF043P24- GCCTCTGCCAGAGTG
JMFN031G05+ ATCAGCATGCCTCTGCCAGAGTG
JMFN037A10+ G
                      ____________________________________________________________
consensus ATCAGCATGCCTCTGCCAGAGTG
 
. : . : . : . : . : . :
rJMFF043P24- CAAAATATCATTGAATTATGGAAGAGAAATTCTACATCCATGAGGAAAACGATACGGGAC
JMFN031G05+ CAAAATATCATTGAATTATGGAAGAGAAATTCTACATCCATGAGGAAAACGATACGGGAC
JMFN037A10+ CAAAATATCATTGAATTATGGAAGAGAAATTCTACATCCATGAGGAAAACGATACGGGAC
JMFN014P22+ CATCCATGAGGAAAACGATACGGGAC
                      ____________________________________________________________
consensus CAAAATATCATTGAATTATGGAAGAGAAATTCTACATCCATGAGGAAAACGATACGGGAC
 
. : . : . : . : . : . :
rJMFF043P24- CATTGTTTTCATGATTCAAGGTTTTATTTTCAAAGTCCATGCTCCTATCAACAAAACACT
JMFN031G05+ CATTGTTTTCATGATTCAAGGTTTTATTTTCAAAGTCCATGCTCCTATCAACAAAACACT
JMFN037A10+ CATTGTTTTCATGATTCAAGGTTTTATTTTCAAAGTCCATGCTCCTATCAACAAAACACT
JMFN014P22+ CATTGTNTTCATGATTCAAGGTTTTATTTTCAAAGTCCATGCTCCTATCAACAAAACACT
JMFN017G11+ TTTCATGATTCAAGGTTTTATTTTCAAAGTCCATGCTCCTATCAACAAAACACT
JMFN037D13+ TTTATTTTCAAAGTCCATGCTCCTATCAACAAAACACT
JMFN005F24+ GGTTTTATTTTCAAAGTCCATGCTCCTATCAACAAAACACT
JMFN014M10+ CATGATTCAAGGTTTANTTTTCAAAGTCCATGCTCCTATCAACAAAACACT
JMFF043P24+ TTCATGATTCAAGGTTTA-TTTTCAAAGTCCATGCTCCTATCAACAAAACACT
JMFN006J13+ TTCAAAGTCCATGCTCCTATCAACAAAACACT
JMFN038O23+ CAAAGTCCATGCTCCTATCAACAAAACACT
                      ____________________________________________________________
consensus CATTGTTTTCATGATTCAAGGTTTTATTTTCAAAGTCCATGCTCCTATCAACAAAACACT
 
. : . : . : . : . : . :
rJMFF043P24- ATACTTCAGTCCTGTACTTCTTTCTTCTTGTCCTTTGACATCAGATACCAGCCCAGAGCA
JMFN031G05+ ATACTTCAGTCCTGTACTTCTTTCTTCTTGTCCTTTGACATCAGATACCAGCCCAGAGCA
JMFN037A10+ ATACTTCAGTCCTGTACTTCTTTCTTCTTGTCCTTTGACATCAGATACCAGCCCAGAGCA
JMFN014P22+ ATACTTCAGTCCTGTACTTCTTTCTTCTTGTCCTTTGACATCAGATACCAGCCCAGAGCA
JMFN017G11+ ATACTTCAGTCCTGTACTTCTTTCTTCTTGTCCTTTGACATCAGATACCAGCCCAGAGCA
JMFN037D13+ ATACTTCAGTCCTGTACTTCTTTCTTCTGTCCCTTGNACATCAGATACCAGCCCAGAGCA
JMFN005F24+ ATACTTCAGTCCTGTACTTCTTTCTTCTTGTCCTTTGACATCAGATACCAGCCCAGAGCA
JMFN014M10+ ATACTTCAGTCCTGTACTTCTTTCTTCTGGTCCTTTGACATCAGATACCAGCCCAGAGCA
JMFF043P24+ ATACTTCAGTCCTGTACTTCTTTCTTCTTGTCCTTTGACATCAGATACCAGCCCAGAGCA
JMFN006J13+ ATACTTCAGTCCTGTACTTCTTTCTTCTTGTCCTTTGACATCAGATACCAGCCCAGAGCA
JMFN038O23+ ATACTTCAGTCCTGTACTTCTTTCTTCTTGTCCTTGNACATCAGATACCAGCCCAGAGCA
                      ____________________________________________________________
consensus ATACTTCAGTCCTGTACTTCTTTCTTCTTGTCCTTTGACATCAGATACCAGCCCAGAGCA
 
. : . : . : . : . : . :
rJMFF043P24- CCAACACCAGTTACAATTCCAGCCAAAACACCATAGTTGCGGTAATTGTCATTCGACACC
JMFN031G05+ CCAACACCAGTTACAATTCCAGCCAAAACACCATAGTTGCGGTAATTGTCATTCGACACC
JMFN037A10+ CCAACACCAGTTACAATTCCAGCCAAAACACCATAGTTGCGGTAATTGTCATTCGACACC
JMFN014P22+ CCAACACCAGTTACAATTCCAGCCAAAACACCATAGTTGCGGTAATTGTCATTCGACACC
JMFN017G11+ CCAACACCAGTTACAATTCCAGCCAAAACACCATAGTTGCGGTAATTGTCATTCGACACC
JMFN037D13+ CCAACACCAGTTACAATTCCAGCCAAAACACCATAGTTGCGGTAATTGTCATTCGACACC
JMFN005F24+ CCAACACCAGTTACAATTCCAGCCAAAACACCATAGTTGCGGTAATTGTCATTCGACACC
JMFN014M10+ CCAACACCAGTTACAATTCCAGCCAAAACACCATAGTTGCGGTAATTGTCATTCGACACC
JMFF043P24+ CCAACACCAGTTACAATTCCAGCCAAAACACCATAGTTGCGGTAATTGTCATTCGACACC
JMFN006J13+ CCAACACCAGTTACAATTCCAGCCAAAACACCATAGTTGCGGTAATTGTCATTCGACACC
JMFN038O23+ CCAACACCAGTTACAATTCCAGCCAAAACACCATAGTTGCGGTAATTGTCATTCGACACC
                      ____________________________________________________________
consensus CCAACACCAGTTACAATTCCAGCCAAAACACCATAGTTGCGGTAATTGTCATTCGACACC
 
. : . : . : . : . : . :
rJMFF043P24- CCGGGTGTTGAGGAGGAGGCTTGAGCACCTGCTTTAGCATCCGCTACAGACCCTGAATCC
JMFN031G05+ CCGGGTGTTGAGGAGGAGGCTTGAGCACCTGCTTTAGCATCCGCTACAGACCCTGAATCC
JMFN037A10+ CCGGGTGTTGAGGAGGAGGCTTGAGCACCTGCTTTAGCATCCGCTACAGACCCTGAATCC
JMFN014P22+ CCGGGTGTTGAGGAGGAGGCTTGAGCACCTGCTTTAGCATCCGCTACAGACCCTGAATCC
JMFN017G11+ CCGGGTGTTGAGGAGGAGGCTTGAGCACCTGCTTTAGCATCCGCTACAGACCCTGAATCC
JMFN037D13+ CCGGGTGTTGAGGAGGAGGCTTGAGCACCTGCTTTAGCATCCGCTACAGACCCTGAATCC
JMFN005F24+ CCGGGTGTTGAGGAGGAGGCTTGAGCACCTGCTTTAGCATCCGCTACAGACCCTGAATCC
JMFN014M10+ CCGGGTGTTGAGGAGGAGGCTTGAGCACCTGCTTTAGCATCCGCTACAGACCCTGAATCC
JMFF043P24+ CCGGGTGTTGAGGAGGAGGCTTGAGCACCTGCTTTAGCATCCGCTACAGACCCTGAATCC
JMFN006J13+ CCGGGTGTTGAGGAGGAGGCTTGAGCACCTGCTTTAGCATCCGCTACAGACCCTGAATCC
JMFN038O23+ CCGGGTGTTGAGGAGGAGGCTTGAGCACCTGCTTTAGCATCCGCTACAGACCCTGAATCC
                      ____________________________________________________________
consensus CCGGGTGTTGAGGAGGAGGCTTGAGCACCTGCTTTAGCATCCGCTACAGACCCTGAATCC
 
. : . : . : . : . : . :
rJMFF043P24- CCAGAGTTGGCAGCAGCTGGTTTTTCTGGATTGGGACCCTTTCGGGCAAGCTTCTCCAAT
JMFN031G05+ CCAGAGTTGGCAGCAGCTGGTTTTTCTGGATTGGGACCCTTTCGGGCAAGCTTCTCCAAT
JMFN037A10+ CCAGAGTTGGCAGCAGCTGGTTTTTCTGGATTGGGACCCTTTCGGGCAAGCTTCTCCAAT
JMFN014P22+ CCAGAGTTGGCAGCAGCTGGTTTTTCTGGATTGGGACCCTTTCGGGCAAGCTTCTCCAAT
JMFN017G11+ CCAGAGTTGGCAGCAGCTGGTTTTTCTGGATTGGGACCCTTTCGGGCAAGCTTCTCCAAT
JMFN037D13+ CCAGAGTTGGCAGCAGCTGGTTTTTCTGGATTGGGACCCTTTCGGGCAAGCTTCTCCAAT
JMFN005F24+ CCAGAGTTGGCAGCAGCTGGTTTTTCTGGATTGGGACCCTTTCGGGCAAGCTTCTCCAAT
JMFN014M10+ CCAGAGTTGGCAGCAGCTGGTTTTTCTGGATTGGGACCCTTTCGGGCAAGCTTCTCCAAT
JMFF043P24+ CCAGAGTTGGCAGCAGCTGGTTTTTCTGGATTGGGACCCTTTCGGGCAAGCTTCTCCAAT
JMFN006J13+ CCAGAGTTGGCAGCAGCTGGTTTTTCTGGATTGGGACCCTTTCGGGCAAGCTTCTCCAAT
JMFN038O23+ CCAGAGTTGGCAGCAGCTGGTTTTTCTGGATTGGGACCCTTTCGGGCAAGCTTCTCCAAT
                      ____________________________________________________________
consensus CCAGAGTTGGCAGCAGCTGGTTTTTCTGGATTGGGACCCTTTCGGGCAAGCTTCTCCAAT
 
. : . : . : . : . : . :
rJMFF043P24- TTCTCCTGCTCAGTTTTCTTGATATAGACATTTTCTGCAGCTTTTTCCTCCTCACTGAGC
JMFN031G05+ TTCTCCTGCTCAGTTTTCTTGATATAGACATTTTCTGCAGCTTTTTCCTCCTCACTGAGC
JMFN037A10+ TTCTCCTGCTCAGTTTTCTTGATATAGACATTTTCTGCAGCTTTTTCCTCCTCACTGAGC
JMFN014P22+ TTCTCCTGCTCAGTTTTCTTGATATAGACATTTTCTGCAGCTTTTTCCTCCTCACTGAGC
JMFN017G11+ TTCTCCTGCTCAGTTTTCTTGATATAGACATTTTCTGCAGCTTTTTCCTCCTCACTGAGC
JMFN037D13+ TTCTCCTGCTCAGTTTTCTTGATATAGACATTTTCTGCAGCTTTTTCCTCCTCACTGAGC
JMFN005F24+ TTCTCCTGCTCAGTTTTCTTGATATAGACATTTTCTGCAGCTTTTTCCTCCTCACTGAGC
JMFN014M10+ TTCTCCTGCTCAGTTTTCTTGATATAGACATTTTCTGCAGCTTTTTCCTCCTCACTGAGC
JMFF043P24+ TTCTCCTGCTCAGTTTTCTTGATATAGACATTTTCTGCAGCTTTTTCCTCCTCACTGAGC
JMFN006J13+ TTCTCCTGCTCAGTTTTCTTGATATAGACATTTTCTGCAGCTTTTTCCTCCTCACTGAGC
JMFN038O23+ TTCTCCTGCTCAGTTTTCTTGATATAGACATTTTCTGCAGCTTTTTCCTCCTCACTGAGC
                      ____________________________________________________________
consensus TTCTCCTGCTCAGTTTTCTTGATATAGACATTTTCTGCAGCTTTTTCCTCCTCACTGAGC
 
. : . : . : . : . : . :
rJMFF043P24- ACCTTGCCACTACTTGAGAACCTACGAGATACATACCTCANAGCATTTCTTGCTGCCATG
JMFN031G05+ ACCTTGCCACTACTTGAGAACCTACGAGATACATACCTCAAAGCATTTCTTGCTGCCATG
JMFN037A10+ ACCTTGCCACTACTTGAGAACCTACGAGATACATACCTCAAAGCATTTCTTGCTGCCATG
JMFN014P22+ ACCTTGCCACTACTTGAGAACCTACGAGATACATACCTCAAAGCATTTCTTGCTGCCATG
JMFN017G11+ ACCTTGCCACTACTTGAGAACCTACGAGATACATACCTCAAAGCATTTCTTGCTGCCATG
JMFN037D13+ ACCTTGCCACTACTTGAGAACCTACGAGATACATACCTCAAAGCATTTCTTGCTGCCATG
JMFN005F24+ ACCTTGCCACTACTTGAGAACCTACGAGATACATACCTCAAAGCATTTCTTGCTGCCATG
JMFN014M10+ ACCTTGCCACTACTTGAGAACCTACGAGATACATACCTCAAAGCATTTCTTGCTGCCATG
JMFF043P24+ ACCTTGCCACTACTTGAGAACCTACGAGATACATACCTCAAAGCATTTCTTGCTGCCATG
JMFN006J13+ ACCTTGCCACTACTTGAGAACCTACGAGATACATACCTCAAAGCATTTCTTGCTGCCATG
JMFN038O23+ ACCTTGCCACTACTTGAGAACCTACGAGATACATACCTCAAAGCATTTCTTGCTGCCATG
                      ____________________________________________________________
consensus ACCTTGCCACTACTTGAGAACCTACGAGATACATACCTCAAAGCATTTCTTGCTGCCATG
 
. : . : . : . : . : . :
rJMFF043P24- AAGAAGTTTCTTCAAACAAATTCCCGGAGAGGCGGATAGCCGGAGACTGGCTTATGAACC
JMFN031G05+ AAGAAGTTTCTTCAAACAAATTCCCGGAGAGGCGGATAGCCGGAGACTGGCTTATGAACC
JMFN037A10+ AAGAAGTTTCTTCAAACAAATTCCCGGAGAGGCGGATAGCCGGAGACTGGCTTATGAACC
JMFN014P22+ AAGAAGTTTCTTCAAACAAATTCCCGGAGAGGCGGATAGCCGGAGACTGGCTTATGAACC
JMFN017G11+ AAGAAGTTTCTTCAAACAAATTCCCGGAGAGGCGGATAGCCGGAGACTGGCTTATGAACC
JMFN037D13+ AAGAAGTTTCTTCAAACAAATTCCCGGAGAGGCGGATAGCCGGAGACTGGCTTATGAACC
JMFN005F24+ AAGAAGTTTCTTCAAACAAATTCCCGGAGAGGCGGATAGCCGGAGACTGGCTTATGAACC
JMFN014M10+ AAGAAGTTTCTTCAAACAAATTCCCGGAGAGGCGGATAGCCGGAGACTGGCTTATGAACC
JMFF043P24+ AAGAAGTTTCTTCAAACAAATTCCCGGAGAGGCGGATAGCCGGAGACTGGCTTATGAACC
JMFN006J13+ AAGAAGTTTCTTCAAACAAATTCCCGGAGAGGCGGATAGCCGGAGACTGGCTTATGAACC
JMFN038O23+ AAGAAGTTTCTTCAAACAAATTCCCGGAGAGGCGGATAGCCGGAGACTGGCTTATGAACC
                      ____________________________________________________________
consensus AAGAAGTTTCTTCAAACAAATTCCCGGAGAGGCGGATAGCCGGAGACTGGCTTATGAACC
 
. : . : . : . : . : . :
rJMFF043P24- C
JMFN031G05+ CACGAAGAGTCGGAGAGGCGAAGCTGGAGACGGAGTGGCTAAGA
JMFN037A10+ CACGAAGAGTCGGAGAGGCGAAGCTGGAGACGGAGTGGCTAAGAGGGTCAGAGGGTAAGA
JMFN014P22+ CACGAAGAGTCGGAGAGGCGAAGCTGGAGACGGAGTGGCTAAGAGGGTCAGAGGGTAAGA
JMFN017G11+ CACGAAGAGTCGGAGAGGCGAAGCTGGAGACGGAGTGGCTAAGAGGGTCAGAGGGTAAGA
JMFN037D13+ CACGAAGAGTCGGAGAGGCGAAGCTGGAGACGGAGTGGCTAAGAGGGTCAGAGGGTAAGA
JMFN005F24+ CACGAAGAGTCGGAGAGGCGAAGCTGGAGACGGAGTGGCTAAGAGGGTCAGAGGGTAAGA
JMFN014M10+ CACGAAGAGTCGGAGAGGCGAAGCTGGAGACGGAGTGGCTAAGAGGGTCAGAGGGTAAGA
JMFF043P24+ CACGAGGAGTCGGAGAGGCGAAGCTGGAGACGGAGTGGCTAAGAGGGTCAGAGGGTAAGA
JMFN006J13+ CACGAAGAGTCGGAGAGGCGAAGCTGGAGACGGAGTGGCTAAGAGGGTCAGAGGGTAAGA
JMFN038O23+ CACGAAGAGTCGGAGAGGCGAAGCTGGAGACGGAGTGGCTAAGAGGGTCAGAGGGTAAGA
                      ____________________________________________________________
consensus CACGAAGAGTCGGAGAGGCGAAGCTGGAGACGGAGTGGCTAAGAGGGTCAGAGGGTAAGA
 
. : . : . : . : . : . :
JMFN037A10+ AGCGGAGAGGCGGAGACGGAGAAAGACTCTGGCGATGGGCCG
JMFN014P22+ AGCGGAGAGGCGGAGACGGAGAAAGACTCTGGCGATGGGCCGATGGTGTCTGGGCGTCTG
JMFN017G11+ AGCGGAGAGGCGGAGACGGAGAAAGACTCTGGCGATGGGCCGATGGTGTCTGGGCGTCTG
JMFN037D13+ AGCGGAGAGGCGGAGACGGAGAAAGACTCTGGCGATGGGCCGATGGTGTCTGGGCGTCTG
JMFN005F24+ AGCGGAGAGGCGGAGACGGAGAAAGACTCTGGCGATGGGCCGATGGTGTCTGGGCGTCTG
JMFN014M10+ AGCGGAGAGGCGGAGACGGAGAAAGACTCTGGCGATGGGCCGATGGTGTCTGGGCGTCTG
JMFF043P24+ AGCGGAGAGGCGGAGACGGAGAAAGACTCTGGCGATGGGCCGATGGTGTCTGGGCGTCTG
JMFN006J13+ AGCGGAGAGGCGGAGACGGAGAAAGACTCTGGCGATGGGCCGATGGTGTCTGGGCGTCTG
JMFN038O23+ AGCGGAGAGGCGGAGACGGAGAAAGACTCTGGCGATGGGCCGATGGTGTCTGGGCGTCTG
                      ____________________________________________________________
consensus AGCGGAGAGGCGGAGACGGAGAAAGACTCTGGCGATGGGCCGATGGTGTCTGGGCGTCTG
 
. : . : . : . : . : . :
JMFN014P22+ GC
JMFN017G11+ GCAATCTAGGTGAGAGACA
JMFN037D13+ GCAATCTAGGTGAGAGACAGAGAGGCGAGAGCGTTTGAGGTGAGGA
JMFN005F24+ GCAATCTAGGTGAGAGACAGAGAGGCGAGAGCGTTTGAGGTGAGGA
JMFN014M10+ GCAATCTAGGTGAGAGACAGAGAGGC
JMFF043P24+ GCAATCTAGGTGAGAGACAGAGAGGCGAGAGCGTNTGAGGTGAGGA
JMFN006J13+ GCAATCTAGGTGAGAGACAGAGAGGCGAGAGCGTTTGAGGTGAGGA
JMFN038O23+ GCAATCTAGGTGAGAGACAGAGAGGCGAGAGCGTTTGAGGTGAGGAGTGAGAGGTGTCAG
                      ____________________________________________________________
consensus GCAATCTAGGTGAGAGACAGAGAGGCGAGAGCGTTTGAGGTGAGGAGTGAGAGGTGTCAG