Previous Contig 002702:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN038J11Sequence528002702 (3)gb:AB025633_15165928e-40Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQM1.>gb:BT005168_16381
JMSF021C13Sequence701005956 (4)gb:AB025633_15165921e-15Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQM1.>gb:BT005168_16381781002702 (3)gb:AP004865_18462245e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P002
JMSF023P18Sequence641005956 (4)gb:AB025633_15165929e-16Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQM1.>gb:BT005168_16381773002702 (3)gb:AP004865_18462245e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P002

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF023P18+ GCGGAACAAGCTACTTACAC-TTTGGCA
rJMSF021C13+ CTATATGTGCGGAACAAGCTACTTACACTTTTGGCA
                      ____________________________________________________________
consensus CTATATGTGCGGAACAAGCTACTTACACTTTTGGCA
 
. : . : . : . : . : . :
rJMSF023P18+ ATTTTATTGGAGTTTGGTGCTCTTATTTGGTATGTCAGTAAGCTCTCATGTCTCTTTATT
rJMSF021C13+ ATTTTATTGGAGTTTGGTGCTCTTATTTGGTATGTCAGTAAGCTCTCATGTCTCTTTATT
                      ____________________________________________________________
consensus ATTTTATTGGAGTTTGGTGCTCTTATTTGGTATGTCAGTAAGCTCTCATGTCTCTTTATT
 
. : . : . : . : . : . :
rJMSF023P18+ TCTTCAGACTGATTAACCTGCACTCTCTAATAGTTTGAGTTGGGAAGACAGAGTGCAGCA
rJMSF021C13+ TCTTCAGACTGATTAACCTGCACTCTCTAATAGTTTGAGTTGGGAAGACAGAGTGCAGCA
                      ____________________________________________________________
consensus TCTTCAGACTGATTAACCTGCACTCTCTAATAGTTTGAGTTGGGAAGACAGAGTGCAGCA
 
. : . : . : . : . : . :
rJMSF023P18+ GGATTTTCTAGTTTGTGACCACTCTAAAACCAAAAAATATACTGCATTCCACATCTCACT
rJMSF021C13+ GGATTTTCTAGTTTGTGACCACTCTAAAACCAAAAAATATACTGCATTCCACATCTCACT
                      ____________________________________________________________
consensus GGATTTTCTAGTTTGTGACCACTCTAAAACCAAAAAATATACTGCATTCCACATCTCACT
 
. : . : . : . : . : . :
rJMSF023P18+ AAGTATGGTGAAATCCAAAGTGAATCTTCATTGCTTTTGAAGTCCCCACATCTGTTGATC
rJMSF021C13+ AAGTATGGTGAAATCCAAAGTGAATCTTCATTGCTTTTGAAGTCCCCACATCTGTTGATC
                      ____________________________________________________________
consensus AAGTATGGTGAAATCCAAAGTGAATCTTCATTGCTTTTGAAGTCCCCACATCTGTTGATC
 
. : . : . : . : . : . :
rJMSF023P18+ ATTGGAATGCTAATTGCCTTAAGTCAATGTTAGCACAATTGCCAACAAAGTTGGTCAAGT
rJMSF021C13+ ATTGGAATGCTAATTGCCTTAAGTCAATGTTAGCACAATTGCCAACAAAGTTGGTCAAGT
                      ____________________________________________________________
consensus ATTGGAATGCTAATTGCCTTAAGTCAATGTTAGCACAATTGCCAACAAAGTTGGTCAAGT
 
. : . : . : . : . : . :
rJMSF023P18+ CTCACATAGCTACATCAGCTAGGTTCATAGGATATTTAGTAATGATTACTGAAAGTCTTG
rJMSF021C13+ CTCACATAGCTACATCAGCTAGGTTCATAGGATATTTAGTAATGATTACTGAAAGTCTTG
                      ____________________________________________________________
consensus CTCACATAGCTACATCAGCTAGGTTCATAGGATATTTAGTAATGATTACTGAAAGTCTTG
 
. : . : . : . : . : . :
rJMSF023P18+ CTCATTTGTTATATACTAAACTAGATTTCTTTGATAGATTTTGCCACACATTGCTGTTTT
rJMSF021C13+ CTCATTTGTTATATACTAAACTAGATTTCTTTGATAGATTTTGCCACACATTGCTGTTTT
                      ____________________________________________________________
consensus CTCATTTGTTATATACTAAACTAGATTTCTTTGATAGATTTTGCCACACATTGCTGTTTT
 
. : . : . : . : . : . :
rJMSF023P18+ TAGCTGAGAATCTTGTTTGCTTCTGTAATTTCAACAGGTATAGCTTGAGTTACATCCCAT
rJMSF021C13+ TAGCTGAGAATCTTGTTTGCTTCTGTAATTTCAACAGGTATAGCTTGAGTTACATCCCAT
JMFN038J11- GGTATAGCTTGAGTTACATCCCAT
                      ____________________________________________________________
consensus TAGCTGAGAATCTTGTTTGCTTCTGTAATTTCAACAGGTATAGCTTGAGTTACATCCCAT
 
. : . : . : . : . : . :
rJMSF023P18+ TTGCAAGGTCCATGGTCTCAAAAGTTATGGTTGCTTGCTTTGATACCGAATTCTAAGTGG
rJMSF021C13+ TTGCAAGGTCCATGGTCTCAAAAGTTATGGTTGCTTGCTTTGATACCGAATTCTAAGTGG
JMFN038J11- TTGCAAGGTCCATGGTCTCAAAAGTTATGGTTGCTTGCTTTGATACCGAATTCTAAGTGG
                      ____________________________________________________________
consensus TTGCAAGGTCCATGGTCTCAAAAGTTATGGTTGCTTGCTTTGATACCGAATTCTAAGTGG
 
. : . : . : . : . : . :
rJMSF023P18+ CATACTCATGAGAGGGGTTCAGATTTGCAATTTCTGTATAGTAGCATGAATCTCATACAT
rJMSF021C13+ CATACTCATGAGAGGGGTTCAGATTTGCAATTTCTGTATAGTAGCATGAATCTCATACAT
JMFN038J11- CATACTCATGAGAGGGGTTCAGATTTGCAATTTCTGTATAGTAGCATGAATCTCATACAT
                      ____________________________________________________________
consensus CATACTCATGAGAGGGGTTCAGATTTGCAATTTCTGTATAGTAGCATGAATCTCATACAT
 
. : . : . : . : . : . :
rJMSF023P18+ GACAAAACCTGGTGTTCTGATCCAGAGATCGGGTTAGGTGAGTGCACCACCTGTGTGTAA
rJMSF021C13+ GACAAAACCTGGTGTTCTGATCCAGAGATCGGGTTAGGTGAGTGCACCACCTGTGTGTAA
JMFN038J11- GACAAAACCTGGTGTTCTGATCCAGAGATCGGGTTAGGTGAGTGCACCACCTGTGTGTAA
                      ____________________________________________________________
consensus GACAAAACCTGGTGTTCTGATCCAGAGATCGGGTTAGGTGAGTGCACCACCTGTGTGTAA
 
. : . : . : . : . : . :
rJMSF023P18+ CTAACTAGTTACAATCATTTTGACTGGACCAACTGCTGGTGCCTATCAACGCTTTTTCTT
rJMSF021C13+ CTAACTAGTTACAATCATTTTGACTGGACCAACTGCTGGTGCCTATCAACGCTTTTTCTT
JMFN038J11- CTAACTAGTTACAATCATTTTGACTGGACCAACTGCTGGTGCCTATCAACGCTTTTTCTT
                      ____________________________________________________________
consensus CTAACTAGTTACAATCATTTTGACTGGACCAACTGCTGGTGCCTATCAACGCTTTTTCTT
 
. : . : . : . : . : . :
rJMSF023P18+ TCTGCTACCGTTGTGCTAGGGATT
rJMSF021C13+ TCTGCTA-CGTTGTGCTAGGGATT
JMFN038J11- TCTGCTA-CGTTGTGCTAGGGATTTGTTTACCCTTGTTAACAAGTGTTATTATCTCTTNC
                      ____________________________________________________________
consensus TCTGCTA-CGTTGTGCTAGGGATTTGTTTACCCTTGTTAACAAGTGTTATTATCTCTTNC