Previous Contig 002700:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043G22Sequence639014957gb:AK055927_19115991e-05Homo sapiens cDNA FLJ31365 fis, clone NB9N41000135, highly similar to RAS-RELATE643002700 (3)gb:SLU38464_17153873e-50Solanum lycopersicum small GTP-binding protein (LeRab1A) mRNA, complete cds.
JMFN036J15Sequence557002700 (3)gb:SLU38464_17153871e-38Solanum lycopersicum small GTP-binding protein (LeRab1A) mRNA, complete cds.
JMFN038H24Sequence638002700 (3)gb:LJRAB1C_16850232e-91L.japonicus mRNA for small GTP-binding protein, RAB1C.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF043G22- A
                      ____________________________________________________________
consensus A
 
. : . : . : . : . : . :
JMFN036J15+ GCCTTAAAAAGGAAAGCATGTGTCATTCACCAC
rJMFF043G22- CCCTGGAGAGTTTTTTTTTTTTTTTTGGCCTTAAAAAGGAAAGCATGTGTCATTCACCAC
                      ____________________________________________________________
consensus CCCTGGAGAGTTTTTTTTTTTTTTTTGGCCTTAAAAAGGAAAGCATGTGTCATTCACCAC
 
. : . : . : . : . : . :
JMFN036J15+ TTGATTTTTATGAAAACAAATCACTAAAACAATGAGGGCAAATACTGCCTTGTAGCAATC
rJMFF043G22- TTGATTTTTATGAAAACAAATCACTAAAACAATGAGGGCAAATACTGCCTTGTAGCAATC
                      ____________________________________________________________
consensus TTGATTTTTATGAAAACAAATCACTAAAACAATGAGGGCAAATACTGCCTTGTAGCAATC
 
. : . : . : . : . : . :
JMFN036J15+ ATCTTCTACACTTTTGTACAAAAGCTGTTTATAACTGAATAGTGGAAAGAATTGGTGTTT
rJMFF043G22- ATCTTCTACACTTTTGTACAAAAGCTGTTTATAACTGAATAGTGGAAAGAATTGGTGTTT
                      ____________________________________________________________
consensus ATCTTCTACACTTTTGTACAAAAGCTGTTTATAACTGAATAGTGGAAAGAATTGGTGTTT
 
. : . : . : . : . : . :
JMFN036J15+ TAACAAAACGCGGGAATGAAAAAATATATATAAAGCAAACATGCAGAATAGTCTACTTCA
rJMFF043G22- TAACAAAACGCGGGAATGAAAAAATATATATAAAGCAAACATGCAGAATAGTCTACTTCA
                      ____________________________________________________________
consensus TAACAAAACGCGGGAATGAAAAAATATATATAAAGCAAACATGCAGAATAGTCTACTTCA
 
. : . : . : . : . : . :
JMFN036J15+ TGTCAAACAACTAAGATTAATTTTACATGCCACATGAAGAGCATCTGAGCATATCCAGAA
rJMFF043G22- TGTCAAACAACTAAGATTAATTTTACATGCCACATGAAGAGCATCTGAGCATATCCAGAA
                      ____________________________________________________________
consensus TGTCAAACAACTAAGATTAATTTTACATGCCACATGAAGAGCATCTGAGCATATCCAGAA
 
. : . : . : . : . : . :
JMFN036J15+ AATAGAATCTCCCTTTCAACTTGAGCAGCAACCAGAATTTTGGTTGACGGGCTGTCCTCG
rJMFF043G22- AATAGAATCTCCCTTTCAACTTGAGCAGCAACCAGAATTTTGGTTGACGGGCTGTCCTCG
                      ____________________________________________________________
consensus AATAGAATCTCCCTTTCAACTTGAGCAGCAACCAGAATTTTGGTTGACGGGCTGTCCTCG
 
. : . : . : . : . : . :
JMFN036J15+ GATCTGCACAGTAGGAGGCCGTGCATTGCTTGAGGAGGGTTGAGTCGCCATTCTGTTTTT
rJMFF043G22- GATCTGCACAGTAGGAGGCCGTGCATTGCTTGAGGAGGGTTGAGTCGCCATTCTGTTTTT
                      ____________________________________________________________
consensus GATCTGCACAGTAGGAGGCCGTGCATTGCTTGAGGAGGGTTGAGTCGCCATTCTGTTTTT
 
. : . : . : . : . : . :
JMFN036J15+ TATTGAACCAGTCATGGCCATGAAAGCCTGCTCCACATTGGTTGCATTTTTTGCACTTGT
rJMFF043G22- TATTGAACCAGTCATGGCCATGAAAGCCTGCTCCACATTGGTTGCATTTTTTGCACTTGT
JMFN038H24+ GTCATGGCCATGAAAGCCTGCTCCACATTGGTTGCATTTTTTGCACTTGT
                      ____________________________________________________________
consensus TATTGAACCAGTCATGGCCATGAAAGCCTGCTCCACATTGGTTGCATTTTTTGCACTTGT
 
. : . : . : . : . : . :
JMFN036J15+ CTCCAGGAATGGAATTCCAATCTCATCAGCAAAAGCCTTGGCTGTCTCATAGGACACAAC
rJMFF043G22- CTCCAGGAATGGAATTCCAATCTCATCAGCAAAAGCCTTGGCTGTCTCATAGGACACAAC
JMFN038H24+ CTCCAGGAATGGAATTCCAATCTCATCAGCAAAAGCCTTGGCTGTCTCATAGGACACAAC
                      ____________________________________________________________
consensus CTCCAGGAATGGAATTCCAATCTCATCAGCAAAAGCCTTGGCTGTCTCATAGGACACAAC
 
. : . : . : . : . : . :
JMFN036J15+ CTTCTGTGCCGTTAGGTCACACTTATTCCCGACAAGAAGCTTGT
rJMFF043G22- CTTCTGTGCCGTTAGGTCACACTTATTCCCGACAAGAAGCTTGTTTACATTCTCACTTGC
JMFN038H24+ CTTCTGTGCCGTTAGGTCACACTTATTCCCGACAAGAAGCTTGTTTACATTCTCACTTGC
                      ____________________________________________________________
consensus CTTCTGTGCCGTTAGGTCACACTTATTCCCGACAAGAAGCTTGTTTACATTCTCACTTGC
 
. : . : . : . : . : . :
rJMFF043G22- ATATCGATCAATTTCATTCAACCATTGCTTGACATTGTTGAA
JMFN038H24+ ATATCGATCAATTTCATTCAACCATTGCTTGACATTGTTGAAACTATCTTGATCAGTGAC
                      ____________________________________________________________
consensus ATATCGATCAATTTCATTCAACCATTGCTTGACATTGTTGAAACTATCTTGATCAGTGAC
 
. : . : . : . : . : . :
JMFN038H24+ ATCATAAACCACAATTATGCCATGAGCCCCACGATAGTAACTGCTGGTAATTGTCCTAAA
                      ____________________________________________________________
consensus ATCATAAACCACAATTATGCCATGAGCCCCACGATAGTAACTGCTGGTAATTGTCCTAAA
 
. : . : . : . : . : . :
JMFN038H24+ CCGTTCTTGACCAGCAGTGTCCCAAATTTGGAGTTTAATGGTTTTCCCCTCCTGTTCCAC
                      ____________________________________________________________
consensus CCGTTCTTGACCAGCAGTGTCCCAAATTTGGAGTTTAATGGTTTTCCCCTCCTGTTCCAC
 
. : . : . : . : . : . :
JMFN038H24+ TGTCCGGATTTTAAAATCTACTCCAATGGTACTGATGTAACTTTCAAGATACGAGTCATC
                      ____________________________________________________________
consensus TGTCCGGATTTTAAAATCTACTCCAATGGTACTGATGTAACTTTCAAGATACGAGTCATC
 
. : . : . : . : . : . :
JMFN038H24+ AGCAAACCTCAGAAGAAGACAGGATTTTCCAACACCAGAATCTCCAATCAGCAAAAGCTT
                      ____________________________________________________________
consensus AGCAAACCTCAGAAGAAGACAGGATTTTCCAACACCAGAATCTCCAATCAGCAAAAGCTT
 
. : . : . : . : . : . :
JMFN038H24+ AAAAAGATAGTCATATTCAGGATTCATAGCTGCAGCACGGCTTGAGATCGATGAGGCTGA
                      ____________________________________________________________
consensus AAAAAGATAGTCATATTCAGGATTCATAGCTGCAGCACGGCTTGAGATCGATGAGGCTGA
 
. : . : . : . : . : . :
JMFN038H24+ ACGGAAATACGTAGAAATTCGGCGGAATTTCCTGTTTCCCGGCAAGAATTAATCAGGCTT
                      ____________________________________________________________
consensus ACGGAAATACGTAGAAATTCGGCGGAATTTCCTGTTTCCCGGCAAGAATTAATCAGGCTT