Previous Contig 002698:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN038H09Sequence493002698 (3)
JMSF033J21Sequence498002698 (3)451002698 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF033J21+ TTTTTTTTTTGGAGAAACAT
JMFN038H09+ TGGAGAAACAT
                      ____________________________________________________________
consensus TTTTTTTTTTGGAGAAACAT
 
. : . : . : . : . : . :
JMSF033J21+ AAAGTATATTGCACAGTATTTACTTACAAAGTGATTGATATGTACAATCGGAGCAGGAAA
rJMSF033J21- AAGTGATTGATATGTACAATCGGAGCAGGAAA
JMFN038H09+ AAAGTATATTGCACAGTATTTACTTACAAAGTGATTGATATGTACAATCGGAGCAGGAAA
                      ____________________________________________________________
consensus AAAGTATATTGCACAGTATTTACTTACAAAGTGATTGATATGTACAATCGGAGCAGGAAA
 
. : . : . : . : . : . :
JMSF033J21+ AAAACAGAAAGATAGAAGCTCCTGTTAATCGCCGCTAGTTTAATTGGTTCATACAAGAAA
rJMSF033J21- AAAACAGAAAGATAGAAGCTCCTGTTAATCGCCGCTAGTTTAATTGGTTCATACAAGAAA
JMFN038H09+ AAAACAGAAAGATAGAAGCTCCTGTTAATCGCCGCTAGTTTAATTGGTTCATACAAGAAA
                      ____________________________________________________________
consensus AAAACAGAAAGATAGAAGCTCCTGTTAATCGCCGCTAGTTTAATTGGTTCATACAAGAAA
 
. : . : . : . : . : . :
JMSF033J21+ CGCCAAAAGAGTGGCACAAAACAGGGGCGGAATTGCTGTGGGGCTGTTGCCGCCGGCGGC
rJMSF033J21- CGCCAAAAGAGTGGCACAAAACAGGGGCGGAATTGCTGTGGGGCTGTTGCCGCCGGCGGC
JMFN038H09+ CGCCAAAAGAGTGGCACAAAACAGGGGCGGAATTGCTGTGGGGCTGTTGCCGCCGGCGGC
                      ____________________________________________________________
consensus CGCCAAAAGAGTGGCACAAAACAGGGGCGGAATTGCTGTGGGGCTGTTGCCGCCGGCGGC
 
. : . : . : . : . : . :
JMSF033J21+ GTTGCGGTGGGAGTTGTGGTGGGCATTCGCAGCATATATGGGTATCACCGCCGACGATCC
rJMSF033J21- GTTGCGGTGGGAGTTGTGGTGGGCATTCGCAGCATATATGGGTATCACCGCCGACGATCC
JMFN038H09+ GTTGCGGTGGGAGTTGTGGTGGGCATTCGCAGCATATATGGGTATCACCGCCGACGATCC
                      ____________________________________________________________
consensus GTTGCGGTGGGAGTTGTGGTGGGCATTCGCAGCATATATGGGTATCACCGCCGACGATCC
 
. : . : . : . : . : . :
JMSF033J21+ GCGGGGATTTTGGTTGGTTGATCCCACGTCGGGCTGGCCGCTTTGGCCGCCGCCGTTGCT
rJMSF033J21- GCGGGGATTTTGGTTGGTTGATCCCACGTCGGGCTGGCCGCTTTGGCCGCCGCCGTTGCT
JMFN038H09+ GCGGGGATTTTGGTTGGTTGATCCCACGTCGGGCTGGCCGCTTTGGCCGCCGCCGTTGCT
                      ____________________________________________________________
consensus GCGGGGATTTTGGTTGGTTGATCCCACGTCGGGCTGGCCGCTTTGGCCGCCGCCGTTGCT
 
. : . : . : . : . : . :
JMSF033J21+ CATTCCTCCTTTGCCACCACCTCCACTCAGCTTGCTTTTCTCCCCTATAGTTCCAGAAGG
rJMSF033J21- CATTCCTCCTTTGCCACCACCTCCACTCAGCTTGCTTTTCTCCCCTATAGTTCCAGAAGG
JMFN038H09+ CATTCCTCCTTTGCCACCACCTCCACTCAGCTTGCTTTTCTCCCCTATAGTTCCAGAAGG
                      ____________________________________________________________
consensus CATTCCTCCTTTGCCACCACCTCCACTCAGCTTGCTTTTCTCCCCTATAGTTCCAGAAGG
 
. : . : . : . : . : . :
JMSF033J21+ TGAGGTCCTCCTAAGGGAAGAAGAAGAAGAGCAAGAACATAGGAAGAGGATGAGAAAGAA
rJMSF033J21- TGAGGTCCTCCTAAGGGAAGAAGAAGAAGAGCAAGAACATAGGAAGAGGATGAGAAAGAA
JMFN038H09+ TGAGGTCCTCCTAAGGGAAGAAGAAGAAGAGCAAGAACATAGGAAGAGGATGAGAAAGAA
                      ____________________________________________________________
consensus TGAGGTCCTCCTAAGGGAAGAAGAAGAAGAGCAAGAACATAGGAAGAGGATGAGAAAGAA
 
. : . : . : . : . : . :
JMSF033J21+ GATCATTTGACTGGTTGCCATGGCTGTCTGCTTAGTTTGCTCCAAGATGATGATGAT
rJMSF033J21- GATCATTTGACTGGTTGCCATGGCTGTCTGCTTAGTTTGCTCCAAGATGATGATGAT
JMFN038H09+ GATCATTTGACTGGTTGCCATGGCTGTCTGCTTAGTTTGCTCCAAGATGATGATGATGTT
                      ____________________________________________________________
consensus GATCATTTGACTGGTTGCCATGGCTGTCTGCTTAGTTTGCTCCAAGATGATGATGATGTT