Previous Contig 002689:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN038B09Sequence596002689 (2)gb:AY085798_15708633e-27Arabidopsis thaliana clone 18284 mRNA, complete sequence.
JMFN046P17Sequence592002689 (2)gb:AY085798_15708633e-27Arabidopsis thaliana clone 18284 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN046P17+ AAGATTTGATTGCTGGAAACTACGATAAAGCTATGAAACTTCAATTCTTCGAAA
JMFN038B09+ ACAAGATTTGATTGCTGGAAACTACGATAAAGCTATGAAACTTCAATTCTTCGAAA
                      ____________________________________________________________
consensus ACAAGATTTGATTGCTGGAAACTACGATAAAGCTATGAAACTTCAATTCTTCGAAA
 
. : . : . : . : . : . :
JMFN046P17+ CCTCATTTCTATTCTGAACCCTTGAACATGGATTGTGGCGCCAGGGGAGGCGTGTCCAGC
JMFN038B09+ CCTCATTTCTATTCTGAACCCTTGAACATGGATTGTGGCGCCAGGGGAGGCGTGTCCAGC
                      ____________________________________________________________
consensus CCTCATTTCTATTCTGAACCCTTGAACATGGATTGTGGCGCCAGGGGAGGCGTGTCCAGC
 
. : . : . : . : . : . :
JMFN046P17+ TGGTAAAGATTGAGGGACGGACCCACGAACCGGAACAATATCCATCCACCAATCACGATG
JMFN038B09+ TGGTAAAGATTGAGGGACGGACCCACGAACCGGAACAATATCCATCCACCAATCACGATG
                      ____________________________________________________________
consensus TGGTAAAGATTGAGGGACGGACCCACGAACCGGAACAATATCCATCCACCAATCACGATG
 
. : . : . : . : . : . :
JMFN046P17+ AAGATGGAGGCGTACGCAAATTTGTTGAGCCAGAATAGCGCACCCTTCTCCCCCATGTAC
JMFN038B09+ AAGATGGAGGCGTACGCAAATTTGTTGAGCCAGAATAGCGCACCCTTCTCCCCCATGTAC
                      ____________________________________________________________
consensus AAGATGGAGGCGTACGCAAATTTGTTGAGCCAGAATAGCGCACCCTTCTCCCCCATGTAC
 
. : . : . : . : . : . :
JMFN046P17+ AACTCCACGGCTTTCTCGTTAAGGCTCATCGAATCCCAGTCCTTTGGCGCTGGTTTTGCT
JMFN038B09+ AACTCCACGGCTTTCTCGTTAAGGCTCATCGAATCCCAGTCCTTTGGCGCTGGTTTTGCT
                      ____________________________________________________________
consensus AACTCCACGGCTTTCTCGTTAAGGCTCATCGAATCCCAGTCCTTTGGCGCTGGTTTTGCT
 
. : . : . : . : . : . :
JMFN046P17+ TTCATTCCCTGTCTCCTGTCCTCCTCCTCCTGCTGACGCTGCTGTCTCCGTTTTCTGGAC
JMFN038B09+ TTCATTCCCTGTCTCCTGTCCTCCTCCTCCTGCTGACGCTGCTGTCTCCGTTTTCTGGAC
                      ____________________________________________________________
consensus TTCATTCCCTGTCTCCTGTCCTCCTCCTCCTGCTGACGCTGCTGTCTCCGTTTTCTGGAC
 
. : . : . : . : . : . :
JMFN046P17+ CCTCTCCGGAACCGAATCCCCACCGTGCTCGATGGCGGGGCAGGCGGAGACGGATCGCTT
JMFN038B09+ CCTCTCCGGAACCGAATCCCCACCGTGCTCGATGGCGGGGCAGGCGGAGACGGATCGCTT
                      ____________________________________________________________
consensus CCTCTCCGGAACCGAATCCCCACCGTGCTCGATGGCGGGGCAGGCGGAGACGGATCGCTT
 
. : . : . : . : . : . :
JMFN046P17+ CCCTCGTCGTTGACGCCATTGCCGCCGGCGGTGCTGGCTTTGATCGGAGATAGTGAGAAG
JMFN038B09+ CCCTCGTCGTTGACGCCATTGCCGCCGGCGGTGCTGGCTTTGATCGGAGATAGTGAGAAG
                      ____________________________________________________________
consensus CCCTCGTCGTTGACGCCATTGCCGCCGGCGGTGCTGGCTTTGATCGGAGATAGTGAGAAG
 
. : . : . : . : . : . :
JMFN046P17+ GAGCGGAAAGAGGTGCCGTGCCGGTGTGATCTAGACGGGAAGCTTGTGAGTGTTGTGGTG
JMFN038B09+ GAGCGGAAAGAGGTGCCGTGCCGGTGTGATCTAGACGGGAAGCTTGTGAGTGTTGTGGTG
                      ____________________________________________________________
consensus GAGCGGAAAGAGGTGCCGTGCCGGTGTGATCTAGACGGGAAGCTTGTGAGTGTTGTGGTG
 
. : . : . : . : . : . :
JMFN046P17+ AATTGGTGGGTGATGGAGAACATGGTTTGAGTTGAGTGGTGGATTAATTTGTGTGAAG
JMFN038B09+ AATTGGTGGGTGATGGAGAACATGGTTTGAGTTGAGTGGTGGATTAATTTGTGTGAAGTT
                      ____________________________________________________________
consensus AATTGGTGGGTGATGGAGAACATGGTTTGAGTTGAGTGGTGGATTAATTTGTGTGAAGTT