Previous Contig 002688:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN003G07Sequence627002688 (2)gb:AK117373_18154128e-36Arabidopsis thaliana At5g54530 mRNA for unknown protein, complete cds, clone: RA
JMFN038B07Sequence609002688 (2)gb:AK117373_18154121e-34Arabidopsis thaliana At5g54530 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN003G07+ AATAATGCTA
                      ____________________________________________________________
consensus AATAATGCTA
 
. : . : . : . : . : . :
JMFN003G07+ CTGTTTGTGTTTTTGATTTTATTCTACTGAAACAGCAACCCAATACATACAGAAGAAGTA
JMFN038B07+ AGAAGAAGTA
                      ____________________________________________________________
consensus CTGTTTGTGTTTTTGATTTTATTCTACTGAAACAGCAACCCAATACATACAGAAGAAGTA
 
. : . : . : . : . : . :
JMFN003G07+ AGCATCTTTTCTATCTTTGAGCTTCAAATAATCCCTTCTCCGCCTTCCTGCTTTTCTTCT
JMFN038B07+ AGCATCTTTTCTATCTTTGAGCTTCAAATAATCCCTTCTCCGCCTTCCTGC-TTTCTTCT
                      ____________________________________________________________
consensus AGCATCTTTTCTATCTTTGAGCTTCAAATAATCCCTTCTCCGCCTTCCTGCTTTTCTTCT
 
. : . : . : . : . : . :
JMFN003G07+ TCAACCCCAAACCCCCTGCATCTTTTTTGCAGTCTGGGGGGTCTTCAAAGAGGGAAAGGG
JMFN038B07+ TCAACCCCAAACCCCCTGCATCTTTTTTGCAGTCTGGGGGGTCTTCAAAGAGGGAAAGGG
                      ____________________________________________________________
consensus TCAACCCCAAACCCCCTGCATCTTTTTTGCAGTCTGGGGGGTCTTCAAAGAGGGAAAGGG
 
. : . : . : . : . : . :
JMFN003G07+ AGAGCTGTTTGTGAGCCAAGCCAATATCAATGAGAATGAGGCCAGAAGAAGGGTCATCAA
JMFN038B07+ AGAGCTGTTTGTGAGCCAAGCCAATATCAATGAGAATGAGGCCAGAAGAAGGGTCATCAA
                      ____________________________________________________________
consensus AGAGCTGTTTGTGAGCCAAGCCAATATCAATGAGAATGAGGCCAGAAGAAGGGTCATCAA
 
. : . : . : . : . : . :
JMFN003G07+ CGATGATGTCTTTGACAGGGAGCCAAACAAAGAGCTCTTCCTGGGAGAAGCCCTGAACGC
JMFN038B07+ CGATGATGTCTTTGACAGGGAGCCAAACAAAGAGCTCTTCCTGGGAGAAGCCCTGAACGC
                      ____________________________________________________________
consensus CGATGATGTCTTTGACAGGGAGCCAAACAAAGAGCTCTTCCTGGGAGAAGCCCTGAACGC
 
. : . : . : . : . : . :
JMFN003G07+ CAGTGAGGCAACCATGGGTGAGATTAGCAGTGACCACACTGTCATAGAAGGCCATGGTGT
JMFN038B07+ CAGTGAGGCAACCATGGGTGAGATTAGCAGTGACCACACTGTCATAGAAGGCCATGGTGT
                      ____________________________________________________________
consensus CAGTGAGGCAACCATGGGTGAGATTAGCAGTGACCACACTGTCATAGAAGGCCATGGTGT
 
. : . : . : . : . : . :
JMFN003G07+ CAAATTTGGTGAGACAAGGCTCATCAAGGAAGACTTGAAGAAGCCCAGATTCTGATACAG
JMFN038B07+ CAAATTTGGTGAGACAAGGCTCATCAAGGAAGACTTGAAGAAGCCCAGATTCTGATACAG
                      ____________________________________________________________
consensus CAAATTTGGTGAGACAAGGCTCATCAAGGAAGACTTGAAGAAGCCCAGATTCTGATACAG
 
. : . : . : . : . : . :
JMFN003G07+ TGTAGTTGCTCACTTCCTTTGGGAACAGACCTGCTGGCAACCCCTTTGACTTTAGAAGAT
JMFN038B07+ TGTAGTTGCTCACTTCCTTTGGGAACAGACCTGCTGGCAACCCCTTTGACTTTAGAAGAT
                      ____________________________________________________________
consensus TGTAGTTGCTCACTTCCTTTGGGAACAGACCTGCTGGCAACCCCTTTGACTTTAGAAGAT
 
. : . : . : . : . : . :
JMFN003G07+ CATGGATGGAGATGGAGAGACATGGAGGGCAAAATAGGAAAGCCAAAAAGAAGAGGAAGA
JMFN038B07+ CATGGATGGAGATGGAGAGACATGGAGGGCAAAATAGGAAAGCCAAAAAGAAGAGGAAGA
                      ____________________________________________________________
consensus CATGGATGGAGATGGAGAGACATGGAGGGCAAAATAGGAAAGCCAAAAAGAAGAGGAAGA
 
. : . : . : . : . : . :
JMFN003G07+ GGTTTTGGAAGGCTGCCATGGATGGATGGAGATCAGAGCTTAAGTTCTCTCACTTTCTTG
JMFN038B07+ GGTTTTGGAAGGCTGCCATGGATGGATGGAGATCAGAGCTTAAGTTCTCTCACTTTCTTG
                      ____________________________________________________________
consensus GGTTTTGGAAGGCTGCCATGGATGGATGGAGATCAGAGCTTAAGTTCTCTCACTTTCTTG
 
. : . : . : . : . : . :
JMFN003G07+ GGGAAGACAGGGTTTAA
JMFN038B07+ GGGAAGACAGGGTTTAAGGGAAGTGTGAATAATGAGTATAGAATGAAGTATGTTTTGGAG
                      ____________________________________________________________
consensus GGGAAGACAGGGTTTAAGGGAAGTGTGAATAATGAGTATAGAATGAAGTATGTTTTGGAG