Previous Contig 002687:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038P12Sequence373002687 (3)gb:AC126223_17405385e-15Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0076N15, complet
JMFN038B04Sequence597002687 (3)gb:AC126223_17405386e-37Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0076N15, complet
JMSF051M20Sequence631020588gb:AY072823_15674074e-65Gossypium hirsutum fiddlehead-like protein (FDH) mRNA, complete cds.742002687 (3)gb:AY072823_15674074e-97Gossypium hirsutum fiddlehead-like protein (FDH) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF051M20+ GGTGAGCTTAATTGGTACT
                      ____________________________________________________________
consensus GGTGAGCTTAATTGGTACT
 
. : . : . : . : . : . :
rJMSF051M20+ CCGGCAAGGACCGCTCCATGNTCATCCCCAACTGNTTTTCCGCATGGGCTGCTCCGCCCT
                      ____________________________________________________________
consensus CCGGCAAGGACCGCTCCATGNTCATCCCCAACTGNTTTTCCGCATGGGCTGCTCCGCCCT
 
. : . : . : . : . : . :
rJMSF051M20+ GCTTCTCTCCAACCGCCGCCGCGACTACGGCCGCGCCAAGTACCGCCTCGAGCACATTGT
                      ____________________________________________________________
consensus GCTTCTCTCCAACCGCCGCCGCGACTACGGCCGCGCCAAGTACCGCCTCGAGCACATTGT
 
. : . : . : . : . : . :
rJMSF051M20+ TCGGACTCACAAAGCCGCCGACGACCGCTCCTTCAGGGCTATTTATCAAAAAGAGGATGA
                      ____________________________________________________________
consensus TCGGACTCACAAAGCCGCCGACGACCGCTCCTTCAGGGCTATTTATCAAAAAGAGGATGA
 
. : . : . : . : . : . :
rJMSF051M20+ TGAAGGCAAGAAGGGGTTGAAGATTAGCAAAGAATTAGTCCGAATAGGGGGAGAGGCACT
                      ____________________________________________________________
consensus TGAAGGCAAGAAGGGGTTGAAGATTAGCAAAGAATTAGTCCGAATAGGGGGAGAGGCACT
 
. : . : . : . : . : . :
rJMSF051M20+ GAAGACCAACATAACCACACTGGGCCCACTAGTTCTGCCGGTGTCGGAGCAGCTCATCTT
                      ____________________________________________________________
consensus GAAGACCAACATAACCACACTGGGCCCACTAGTTCTGCCGGTGTCGGAGCAGCTCATCTT
 
. : . : . : . : . : . :
rJMSF051M20+ CTTCGCAACGCTGGTATGGGGCCACCTGTTTGGCTCCTCCTCGCAGCGGCCGTACATACC
                      ____________________________________________________________
consensus CTTCGCAACGCTGGTATGGGGCCACCTGTTTGGCTCCTCCTCGCAGCGGCCGTACATACC
 
. : . : . : . : . : . :
rJMSF051M20+ GGACTACAAGCTGGCCTTCGACCACTTTTGCATCTACGCGCCCAGCAAGGTGGTTTTGGA
                      ____________________________________________________________
consensus GGACTACAAGCTGGCCTTCGACCACTTTTGCATCTACGCGCCCAGCAAGGTGGTTTTGGA
 
. : . : . : . : . : . :
rJMSF051M20+ CGAGTTGCAGGCCAACATGGGCCTGAGGGACGGCGACATGGAGCCCAGCCGCGCCACGCT
                      ____________________________________________________________
consensus CGAGTTGCAGGCCAACATGGGCCTGAGGGACGGCGACATGGAGCCCAGCCGCGCCACGCT
 
. : . : . : . : . : . :
rJMSF051M20+ ACACCGCTTCGGCAACACTTCCAGCAGCAGCATATGGTACGAGCTGGCGTACTTGGAGGC
JMFN038B04- CACCGCTTCGGCAACACTTCCAGCAGCAGCATATGGTACGAGCTGGCGTACTTGGAGGC
                      ____________________________________________________________
consensus ACACCGCTTCGGCAACACTTCCAGCAGCAGCATATGGTACGAGCTGGCGTACTTGGAGGC
 
. : . : . : . : . : . :
rJMSF051M20+ CAAGGGGAAGGTGGCCGGCGGCGACCGCCTCTGGCAGATCGTGTTCGGGTCCGGTTTCAA
rJMFF038P12+ GGGGAAGGTGGCCGGCGGCGACCGCCTCTGGCAGATCGTGTTCGGGTCCGGTTTCAA
JMFN038B04- CAAGGGGAAGGTGGCCGGCGGCGACCGCCTCTGGCAGATCGTGTTCGGGTCCGGTTTCAA
                      ____________________________________________________________
consensus CAAGGGGAAGGTGGCCGGCGGCGACCGCCTCTGGCAGATCGTGTTCGGGTCCGGTTTCAA
 
. : . : . : . : . : . :
rJMSF051M20+ ATGCAACAGCGCCGTGTGGCGGGCCGTACGCCGCATCAGGATGCCCACCGCCAACCCCTG
rJMFF038P12+ ATGCAACAGCGCCGTGTGGCGGGCCGTACGCCGCATCAGGATGCCCNCCGCCAACCCCTG
JMFN038B04- ATGCAACAGCGCCGTGTGGCGGGCCGTACGCCGCATCAGGATGCCCACCGCCAACCCCTG
                      ____________________________________________________________
consensus ATGCAACAGCGCCGTGTGGCGGGCCGTACGCCGCATCAGGATGCCCACCGCCAACCCCTG
 
. : . : . : . : . : . :
rJMSF051M20+ GCTCGACTGCATCCACACCTATCCTCGGGCCATCTAGCTAGGGTACGGTGCAACGTAACA
rJMFF038P12+ GCTCGANTGCATCCACACCTATCCTCGGGCCATCTAGCTAGGGTACGGTGCAACGTAACA
JMFN038B04- GCTCGACTGCATCCACACCTATCCTCGGGCCATCTAGCTAGGGTACGGTGCAACGTAACA
                      ____________________________________________________________
consensus GCTCGACTGCATCCACACCTATCCTCGGGCCATCTAGCTAGGGTACGGTGCAACGTAACA
 
. : . : . : . : . : . :
rJMSF051M20+ TAA
rJMFF038P12+ TAACATATATGCAATGCATGATTTATTATTATTATTGAGTTAATATGTGGTCCTCTTAAT
JMFN038B04- TAACATATATGCAATGCATGATTTATTATTATTATTGAGTTAATATGTGGTCCTCTTAAT
                      ____________________________________________________________
consensus TAACATATATGCAATGCATGATTTATTATTATTATTGAGTTAATATGTGGTCCTCTTAAT
 
. : . : . : . : . : . :
rJMFF038P12+ ATAGTGGTTTTGCCATTTCTAATCCTAAACTTTTAAATTGATCACCCCCGTCTTTTGATT
JMFN038B04- ATAGTGGTTTTGCCATTTCTAATCCTAAACTTTTAAATTGATCACCCCCGTCTTTTGATT
                      ____________________________________________________________
consensus ATAGTGGTTTTGCCATTTCTAATCCTAAACTTTTAAATTGATCACCCCCGTCTTTTGATT
 
. : . : . : . : . : . :
rJMFF038P12+ TTCAAATTATTATTGGTCNTACAAGACAGGCAGGGGTTCGACTAACTTCGAAGGCCACCA
JMFN038B04- TTCAAATTATTATTGGTCCTACAAGACAGGCAGGGGTTCGACTAACTTCGAAGGCCACCA
                      ____________________________________________________________
consensus TTCAAATTATTATTGGTCCTACAAGACAGGCAGGGGTTCGACTAACTTCGAAGGCCACCA
 
. : . : . : . : . : . :
rJMFF038P12+ AAAACAATTCTAAGAA
JMFN038B04- AAAACAATTTTAAGAATGTTTTTATTTGTCATTATATTATATTGATTGCATTCGATCGGC
                      ____________________________________________________________
consensus AAAACAATTTTAAGAATGTTTTTATTTGTCATTATATTATATTGATTGCATTCGATCGGC
 
. : . : . : . : . : . :
JMFN038B04- ATAAAATTTGTATGTCATTGTAATATTATAATAATCGTATCAATTTTTTTTAAAAAAAAA
                      ____________________________________________________________
consensus ATAAAATTTGTATGTCATTGTAATATTATAATAATCGTATCAATTTTTTTTAAAAAAAAA