Previous Contig 002679:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002B19Sequence578003263 (4)sp|Q96372|CC48_CAPAN2e-75Cell division cycle protein 48 homolog.>gb:CACAFP_1644846 C.annuum mRNA for CDC4714002679 (3)sp|Q96372|CC48_CAPAN1e-78Cell division cycle protein 48 homolog.>gb:CACAFP_1644846 C.annuum mRNA for CDC4
JMFN037C01Sequence393002679 (3)sp|Q96372|CC48_CAPAN3e-09Cell division cycle protein 48 homolog.>gb:CACAFP_1644846 C.annuum mRNA for CDC4
JMFS151F09Sequence633002679 (3)gb:AY456394_16071842e-55'Chlorella' ellipsoidea cell division cycle protein 48 mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF002B19+ GTCCCGGTCGTCTTGAC
                      ____________________________________________________________
consensus GTCCCGGTCGTCTTGAC
 
. : . : . : . : . : . :
JMFS151F09- CAATTAATATATATCCCTCTTCCAGATGAAGATTCTCGGCATCAGATCTTCAAAGCTTGC
rJMFF002B19+ CAATTAATATATATCCCTCTTCCAGATGAAGATTCTCGGCATCAGATCTTCAAAGCTTGC
                      ____________________________________________________________
consensus CAATTAATATATATCCCTCTTCCAGATGAAGATTCTCGGCATCAGATCTTCAAAGCTTGC
 
. : . : . : . : . : . :
JMFS151F09- CTGAGAAAATCTCCAGTTTCCAAAGATGTTGATATAAGAGCTCTTGCGAAATACACTCAT
rJMFF002B19+ CTGAGAAAATCTCCAGTTTCCAAAGATGTTGATATAAGAGCTCTTGCGAAATACACTCAT
                      ____________________________________________________________
consensus CTGAGAAAATCTCCAGTTTCCAAAGATGTTGATATAAGAGCTCTTGCGAAATACACTCAT
 
. : . : . : . : . : . :
JMFS151F09- GGATTTAGTGGAGCAGATATCACAGAGATCTGCCAGAGGGCATGCAAATACGCCATACGG
rJMFF002B19+ GGATTTAGTGGAGCAGATATCACAGAGATCTGCCAGAGGGCATGCAAATACGCCATACGG
                      ____________________________________________________________
consensus GGATTTAGTGGAGCAGATATCACAGAGATCTGCCAGAGGGCATGCAAATACGCCATACGG
 
. : . : . : . : . : . :
JMFS151F09- GAGAACAT--AGAAAGATATCGAAAGGGAGAAGCAGAGGAGGGAGAATCCCGATTCCATG
rJMFF002B19+ GAGAACATAGAGAAAGATATCGAAAGGGAGAAGCAGAGGAGGGAGAATCCCGATTCCATG
                      ____________________________________________________________
consensus GAGAACATAGAGAAAGATATCGAAAGGGAGAAGCAGAGGAGGGAGAATCCCGATTCCATG
 
. : . : . : . : . : . :
JMFS151F09- GACGAGGATGATGCTGGGGATGAAGTTTCAGAGATTAAACCTGCGCATTTTGAGGAATCC
rJMFF002B19+ GACGAGGATGATGCTGGGGATGAAGTTTCAGAGATTAAACCTGCGCATTTTGAGGAATCC
                      ____________________________________________________________
consensus GACGAGGATGATGCTGGGGATGAAGTTTCAGAGATTAAACCTGCGCATTTTGAGGAATCC
 
. : . : . : . : . : . :
JMFS151F09- ATGAAGTATGCTCGTCGGAGTGTGAGTGATGCCGATATACGCAAATACCAATCCTTTGCT
rJMFF002B19+ ATGAAGTATGCTCGTCGGAGTGTGAGTGATGCCGATATACGCAAATACCAATCCTTTGCT
JMFN037C01+ GATGCCGATATACGCAAATACCAATCCTTTGCT
                      ____________________________________________________________
consensus ATGAAGTATGCTCGTCGGAGTGTGAGTGATGCCGATATACGCAAATACCAATCCTTTGCT
 
. : . : . : . : . : . :
JMFS151F09- CAAACACTGCAACAATCTCGCGGTTTTGGAACTGAATTCCGCTTTGCTGAGTCAGGAACT
rJMFF002B19+ CAAACACTGCAACAATCTCGCGGTTTTGGAACTGAATTCCGCTTTGCTGAGTCAGGAACT
JMFN037C01+ CAAACACTGCAACAATCTCGCGGTTTTGGAACTGAATTCCGCTTTGCTGAGTCAGGAACT
                      ____________________________________________________________
consensus CAAACACTGCAACAATCTCGCGGTTTTGGAACTGAATTCCGCTTTGCTGAGTCAGGAACT
 
. : . : . : . : . : . :
JMFS151F09- GGCGGGGCCTCTGGAGCCGACCCATTTGCAACCTCTACTGCAGCAGCTGATGAAGACGAC
rJMFF002B19+ GGCGGGGCCTCTGGAGCCGACCCATTTGCAACCTCTACTGCAGCAGNTGATGAAGACGAC
JMFN037C01+ GGCGGGGCCTCTGGAGCCGACCCATTTGCAACCTTTACTGCAGCAGCTGATGAAGACGAC
                      ____________________________________________________________
consensus GGCGGGGCCTCTGGAGCCGACCCATTTGCAACCTCTACTGCAGCAGCTGATGAAGACGAC
 
. : . : . : . : . : . :
JMFS151F09- TTGTATAGCTAAG
rJMFF002B19+ TTGTATAGCTAAGTTTTAGATATATATATATATATGCCCTTTAGTATTAATTATTAGTGT
JMFN037C01+ TTGTATAGCTAAGTTTTAGATATATATATATATATGCCCTTTAGTATTAATTATTAGTGT
                      ____________________________________________________________
consensus TTGTATAGCTAAGTTTTAGATATATATATATATATGCCCTTTAGTATTAATTATTAGTGT
 
. : . : . : . : . : . :
rJMFF002B19+ TTAGGCTACTTTTTTTTGGGTTCCGTTCAGATATTTTTACTCTTGCACTGCAATTCCCTT
JMFN037C01+ TTAGGCTACTTTTTTTTGGGTTCCGTTCAGATATTTTTACTCTTGCACTGCAATTCCCTT
                      ____________________________________________________________
consensus TTAGGCTACTTTTTTTTGGGTTCCGTTCAGATATTTTTACTCTTGCACTGCAATTCCCTT
 
. : . : . : . : . : . :
rJMFF002B19+ TTCTTGATATCTGGATTAAATATTTATATATGGTAGACGTCAGATAATCTCATATCTTAC
JMFN037C01+ TTCTTGATATCTGGATTAAATATTTATATATGGTAGACGTCAGATAATCTCATATCTTAC
                      ____________________________________________________________
consensus TTCTTGATATCTGGATTAAATATTTATATATGGTAGACGTCAGATAATCTCATATCTTAC
 
. : . : . : . : . : . :
rJMFF002B19+ GCACTCCATACTA
JMFN037C01+ GCACTCCATACTACCXXXXXXXXXXXXXXXXXXXXXXXXXXCTGAGACTAGTTCTCTCTC
                      ____________________________________________________________
consensus GCACTCCATACTACCNNNNNNNNNNNNNNNNNNNNNNNNNNCTGAGACTAGTTCTCTCTC