Previous Contig 002676:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN036N19Sequence626002676 (5)gb:AY058060_15641993e-61Arabidopsis thaliana AT5g24910/F6A4_120 mRNA, complete cds.>gb:BT002687_1636290
JMSF026F17Sequence571006912 (4)gb:AY058060_15641992e-35Arabidopsis thaliana AT5g24910/F6A4_120 mRNA, complete cds.>gb:BT002687_1636290 797002676 (5)gb:AY058060_15641992e-84Arabidopsis thaliana AT5g24910/F6A4_120 mRNA, complete cds.>gb:BT002687_1636290
JMSF027F17Sequence585006912 (4)gb:AY058060_15641994e-37Arabidopsis thaliana AT5g24910/F6A4_120 mRNA, complete cds.>gb:BT002687_1636290 673002676 (5)gb:AY058060_15641993e-83Arabidopsis thaliana AT5g24910/F6A4_120 mRNA, complete cds.>gb:BT002687_1636290
JMSF033N12Sequence667006912 (4)gb:AY058060_15641993e-44Arabidopsis thaliana AT5g24910/F6A4_120 mRNA, complete cds.>gb:BT002687_1636290 767002676 (5)gb:AY058060_15641992e-82Arabidopsis thaliana AT5g24910/F6A4_120 mRNA, complete cds.>gb:BT002687_1636290
JMSF033P15Sequence626002676 (5)gb:AY058060_15641995e-66Arabidopsis thaliana AT5g24910/F6A4_120 mRNA, complete cds.>gb:BT002687_1636290 769006912 (4)gb:AY058060_15641994e-39Arabidopsis thaliana AT5g24910/F6A4_120 mRNA, complete cds.>gb:BT002687_1636290

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF033N12+ CAGTGCATACTG
rJMSF027F17+ CAGTGCATACTG
rJMSF026F17+ AAGGACCTGTTGCAGTGCATACTG
                      ____________________________________________________________
consensus AAGGACCTGTTGCAGTGCATACTG
 
. : . : . : . : . : . :
rJMSF033N12+ GAAGCCGCCATTAACGATGAAAACATGGACGAGAATACGTCGAGGAAATTCATAGTCGAT
rJMSF027F17+ GAAGCCGCCATTAACGATGAAAACATGGACGAGAATACGTCGAGGAAATTCATAGTCGAT
rJMSF026F17+ GAAGCCGCCATTAACGATGAAAACATGGACGAGAATACGTCGAGGAAATTCATAGTCGAT
                      ____________________________________________________________
consensus GAAGCCGCCATTAACGATGAAAACATGGACGAGAATACGTCGAGGAAATTCATAGTCGAT
 
. : . : . : . : . : . :
rJMSF033N12+ AACTGCAAGAACCTGTATTTTGCAGGCCACGAGGCCACCGCTGTGGCTGCATCCTGGTGC
rJMSF027F17+ AACTGCAAGAACCTGTATTTTGCAGGCCACGAGGCCACCGCTGTGGCTGCATCCTGGTGC
rJMSF026F17+ AACTGCAAGAACCTGTATTTTGCAGGCCACGAGGCCACCGCTGTGGCTGCATCCTGGTGC
                      ____________________________________________________________
consensus AACTGCAAGAACCTGTATTTTGCAGGCCACGAGGCCACCGCTGTGGCTGCATCCTGGTGC
 
. : . : . : . : . : . :
rJMSF033N12+ CTTATGCTCTTAGCTCTCCACCCGGAATGGCAGACCCGTATACGCGAGGAGATGGACCAG
rJMSF027F17+ CTTATGCTCTTAGCTCTCCACCCGGAATGGCAGACCCGTATACGCGAGGAGATGGACCAG
JMSF033P15+ TCTTAGCTCTCCACCCGGAATGGCAGACCCGTATACGCGAGGAGATGGACCAG
rJMSF026F17+ CTTATGCTCTTAGCTCTCCACCCGGAATGGCAGACCCGTATACGCGAGGAGATGGACCAG
JMFN036N19- CCCGTATACGCGAGGAGATGGACCAG
                      ____________________________________________________________
consensus CTTATGCTCTTAGCTCTCCACCCGGAATGGCAGACCCGTATACGCGAGGAGATGGACCAG
 
. : . : . : . : . : . :
rJMSF033N12+ CTCTGCCCCAATGGCCATCTCGATGCCGAATCGATCACCAAGATGAAGGTGGTGACGATG
rJMSF027F17+ CTCTGCCCCAATGGCCATCTCGATGCCGAATCGATCACCAAGATGAAGGTGGTGACGATG
JMSF033P15+ CTCTGCCCCAATGGCCATCTCGATGCCGAATCGATCACCAAGATGAAGGTGGTGACGATG
rJMSF026F17+ CTCTGCCCCAATGGCCATCTCGATGCCGAATCGATCACCAAGATGAAGGTGGTGACGATG
JMFN036N19- CTCTGCCCCAATGGCCATCTCGATGCCGAATCGATCACCAAGATGAAGGTGGTGACGATG
                      ____________________________________________________________
consensus CTCTGCCCCAATGGCCATCTCGATGCCGAATCGATCACCAAGATGAAGGTGGTGACGATG
 
. : . : . : . : . : . :
rJMSF033N12+ GTGATTAATGAAGTCCTGCGTCTTTACCCACCGGCTGCATTCGTCTCGAGAGAAGCCCTC
rJMSF027F17+ GTGATTAATGAAGTCCTGCGTCTTTACCCACCGGCTGCATTCGTCTCGAGAGAAGCCCTC
JMSF033P15+ GTGATTAATGAAGTCCTGCGTCTTTACCCACCGGCTGCATTCGTCTCGAGAGAAGCCCTC
rJMSF026F17+ GTGATTAATGAAGTCCTGCGTCTTTACCCACCGGCTGCATTCGTCTCGAGAGAAGCCCTC
JMFN036N19- GTGATTAATGAAGTCCTGCGTCTTTACCCACCGGCTGCATTCGTCTCGAGAGAAGCCCTC
                      ____________________________________________________________
consensus GTGATTAATGAAGTCCTGCGTCTTTACCCACCGGCTGCATTCGTCTCGAGAGAAGCCCTC
 
. : . : . : . : . : . :
rJMSF033N12+ GAGGAAACACGGATAGGCCACGTCCTCGTGCCCAAAGGGGTGTGCGTATGGACATTGATC
rJMSF027F17+ GAGGAAACACGGATAGGCCACGTCCTCGTGCCCAAAGGGGTGTGCGTATGGACATTGATC
JMSF033P15+ GAGGAAACACGGATAGGCCACGTCCTCGTGCCCAAAGGGGTGTGCGTATGGACATTGATC
rJMSF026F17+ GAGGAAACACGGATAGGCCACGTCCTCGTGCCCAAAGGGGTGTGCGTATGGACATTGATC
JMFN036N19- GAGGAAACACGGATAGGCCACGTCCTCGTGCCCAAAGGGGTGTGCGTATGGACATTGATC
                      ____________________________________________________________
consensus GAGGAAACACGGATAGGCCACGTCCTCGTGCCCAAAGGGGTGTGCGTATGGACATTGATC
 
. : . : . : . : . : . :
rJMSF033N12+ CCGACTCTGCACCGTGACCCCGAGCTATGGGGGCAGGACGCAAACGAGTTTAAGCCCGAG
rJMSF027F17+ CCGACTCTGCACCGTGACCCCGAGCTATGGGGGCAGGACGCAAACGAGTTTAAGCCCGAG
JMSF033P15+ CCGACTCTGCACCGTGACCCCGAGCTATGGGGGCAGGACGCAAACGAGTTTAAGCCCGAG
rJMSF026F17+ CCGACTCTGCACCGTGACCCCGAGCTATGGGGGCAGGACGCAAACGAGTTTAAGCCCGAG
JMFN036N19- CCGACTCTGCACCGTGACCCCGAGCTATGGGGGCAGGACGCAAACGAGTTTAAGCCCGAG
                      ____________________________________________________________
consensus CCGACTCTGCACCGTGACCCCGAGCTATGGGGGCAGGACGCAAACGAGTTTAAGCCCGAG
 
. : . : . : . : . : . :
rJMSF033N12+ AGGTTTGCCAACGGCGTCTCCAATGCCTGCAAAGTGCCACAAGTTTTCATCCCGTTCGGG
rJMSF027F17+ AGGTTTGCCAACGGCGTCTCCAATGCCTGCAAAGTGCCACAAGTTTTCATCCCGTTCGGG
JMSF033P15+ AGGTTTGCCAACGGCGTCTCCAATGCCTGCAAAGTGCCACAAGTTTTCATCCCGTTCGGG
rJMSF026F17+ AGGTTTGCCAACGGCGTCTCCAATGCCTGCAAAGTGCCACAAGTTTTCATCCCGTTCGGG
JMFN036N19- AGGTTTGCCAACGGCGTCTCCAATGCCTGCAAAGTGCCACAAGTTTTCATCCCGTTCGGG
                      ____________________________________________________________
consensus AGGTTTGCCAACGGCGTCTCCAATGCCTGCAAAGTGCCACAAGTTTTCATCCCGTTCGGG
 
. : . : . : . : . : . :
rJMSF033N12+ GTCGGTCCTCGCCTCTGTGTTGGCCGCAACTTCGCCTTGGTTGAGCTCAAAGTTGTGTTG
rJMSF027F17+ GTCGGTCCTCGCCTCTGTGTTGGCCGCAACTTCGCCTTGGTTGAGCTCAAAGTTGTGTTG
JMSF033P15+ GTCGGTCCTCGCCTCTGTGTTGGCCGCAACTTCGCCTTGGTTGAGCTCAAAGTTGTGTTG
rJMSF026F17+ GTCGGTCCTCGCCTCTGTGTTGGCCGCAACTTCGCCTTGGTTGAGCTCAAAGTTGTGTTG
JMFN036N19- GTCGGTCCTCGCCTCTGTGTTGGCCGCAACTTCGCCTTGGTTGAGCTCAAAGTTGTGTTG
                      ____________________________________________________________
consensus GTCGGTCCTCGCCTCTGTGTTGGCCGCAACTTCGCCTTGGTTGAGCTCAAAGTTGTGTTG
 
. : . : . : . : . : . :
rJMSF033N12+ TCTTTCATAGTCTCCAAGCTCTCGTTCTCGCTTTCTCCAAAGTACAAACACTCCCCTGCT
rJMSF027F17+ TCTTTCATAGTCTCCAAGCTCTCGTTCTCGCTTTCTCCAAAGTACAAACACTCCCCTGCT
JMSF033P15+ TCTTTCATAGTCTCCAAGCTCTCGTTCTCGCTTTCTCCAAAGTACAAACACTCCCCTGCT
rJMSF026F17+ TCTTTCATAGTCTCCAAGCTCTCGTTCTCGCTTTCTCCAAAGTACAAACACTCCCCTGCT
JMFN036N19- TCTTTCATAGTCTCCAAGCTCTCGTTCTCGCTTTCTCCAAAGTACAAACACTCCCCTGCT
                      ____________________________________________________________
consensus TCTTTCATAGTCTCCAAGCTCTCGTTCTCGCTTTCTCCAAAGTACAAACACTCCCCTGCT
 
. : . : . : . : . : . :
rJMSF033N12+ TTCCAGATGGTCGTTTCGCCTGGAAAAGGAGTAAGAATTCTGATTCAGAGATTGAAGAAA
rJMSF027F17+ TTCCAGATGGTCGTTTNGCCTGGAAAAGGAGTAAGAATTTTGATTCAGAGATTG
JMSF033P15+ TTCCAGATGGTCGTTTCGCCTGGAAAAGGAGTAAGAATTCTGATTCAGAGATTGAAGAAA
rJMSF026F17+ TTCCAGATGGTCGTTTCGCCTGGAAAAGGAGTAAGAATTCTGATTCAGAGATTGAAGAAA
JMFN036N19- TTCCAGATGGTCGTTTCGCCTGGAAAAGGAGTAAGAATTCTGATTCAGAGATTGAAGAAA
                      ____________________________________________________________
consensus TTCCAGATGGTCGTTTCGCCTGGAAAAGGAGTAAGAATTCTGATTCAGAGATTGAAGAAA
 
. : . : . : . : . : . :
rJMSF033N12+ TAGGATTAGGTTCTAATGGCATCAAACCTCAGATGT-ACTCCAATAAAAAAACACAAAAA
JMSF033P15+ TAGGATTAGGTTCTAATGGCATCAAACCTCAGATGT-ACTCCAATAAAAAAACACAAAAA
rJMSF026F17+ TAGGATTAGGTTCTAATGGCATCAAACCTCAGATGT-ACTCCAATAAAAAAACACAAAAA
JMFN036N19- TAGGATTAGGTTCTAATGGCATCAAACCTCAGATGTNACTCCATAAAAAAAACACAAAAA
                      ____________________________________________________________
consensus TAGGATTAGGTTCTAATGGCATCAAACCTCAGATGT-ACTCCAATAAAAAAACACAAAAA
 
. : . : . : . : . : . :
rJMSF033N12+ CTTTTAGGAAATCCTATGTACTTGAGGTCTGG
JMSF033P15+ CTTTTAGGAAATCCTATGTACTTGAGGTCTGG
rJMSF026F17+ CTTTTAGGAAATCCTATGTACTTGAGGTCTGGGAACCATAATTTCTGCAAT
JMFN036N19- CTTTTAGGAAATCCTATGTACTTGAGGTCTGGGAACCATAATTTCTGCAATTATCTGATC
                      ____________________________________________________________
consensus CTTTTAGGAAATCCTATGTACTTGAGGTCTGGGAACCATAATTTCTGCAATTATCTGATC