Previous Contig 002660:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN036C12Sequence641002660 (3)gb:AP003705_18321692e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11
JMSF032H14Sequence681006828 (3)sp|P82869|TL38_ARATH8e-32Peptidyl-prolyl cis-trans isomerase TLP38, chloroplast precursor (EC 5.2.1.8) (P770002660 (3)gb:AP003705_18321698e-93Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11
JMSF041G24Sequence727006828 (3)sp|P82869|TL38_ARATH8e-44Peptidyl-prolyl cis-trans isomerase TLP38, chloroplast precursor (EC 5.2.1.8) (P671002660 (3)gb:AP003705_18321697e-78Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032H14+ TTTTNGTTGCCTGAACAGTACC
                      ____________________________________________________________
consensus TTTTNGTTGCCTGAACAGTACC
 
. : . : . : . : . : . :
rJMSF041G24+ GGAGATG
rJMSF032H14+ TGAACTATCCAAGGCTCACAGGAAGAGGAATGGTCGAATTCACAGTTGAGAAGGGAGATG
                      ____________________________________________________________
consensus TGAACTATCCAAGGCTCACAGGAAGAGGAATGGTCGAATTCACAGTTGAGAAGGGAGATG
 
. : . : . : . : . : . :
rJMSF041G24+ GTTCATTG-TTTCTCCAGAATCTGGTGGTGAAGGAAAGAGCATCACAAAAATTCAGGTTG
rJMSF032H14+ GTTCATTGTTTTCTCCAGAATCTGGTGGTGAAGGAAAGAGCATCACAAAAATTCAGGTTG
                      ____________________________________________________________
consensus GTTCATTGTTTTCTCCAGAATCTGGTGGTGAAGGAAAGAGCATCACAAAAATTCAGGTTG
 
. : . : . : . : . : . :
rJMSF041G24+ TTTTAGACGGGTATTCAGCACCACTGACAGCAGGAAACTTTGCAAAACTGGTGATTGATG
rJMSF032H14+ TTTTAGACGGGTATTCAGCACCACTGACAGCAGGAAACTTTGCAAAACTGGTGATTGATG
                      ____________________________________________________________
consensus TTTTAGACGGGTATTCAGCACCACTGACAGCAGGAAACTTTGCAAAACTGGTGATTGATG
 
. : . : . : . : . : . :
rJMSF041G24+ GTGCGTATGATGGTGTGAAGCTCAACTGTGCCAATCAAGCAATTCTTACAGAAAGCAGGT
rJMSF032H14+ GTGCGTATGATGGTGTGAAGCTCAACTGTGCCAATCAAGCAATTCTTACAGAAAGCAGGT
                      ____________________________________________________________
consensus GTGCGTATGATGGTGTGAAGCTCAACTGTGCCAATCAAGCAATTCTTACAGAAAGCAGGT
 
. : . : . : . : . : . :
rJMSF041G24+ TGGGGAAGGACATTGGATATAGCGTTCCCTTAGAGATCATGCCGTCTGGGCAGTTTGAGC
rJMSF032H14+ TGGGGAAGGACATTGGATATAGCGTTCCCTTAGAGATCATGCCGTCTGGGCAGTTTGAGC
                      ____________________________________________________________
consensus TGGGGAAGGACATTGGATATAGCGTTCCCTTAGAGATCATGCCGTCTGGGCAGTTTGAGC
 
. : . : . : . : . : . :
rJMSF041G24+ CACTATACAAAACAACTTTGAGTGTGCAGGATGGGGAGCTTCCTGTGCTTCCGTTATCAG
rJMSF032H14+ CACTATACAAAACAACTTTGAGTGTGCAGGATGGGGAGCTTCCTGTGCTTCCGTTATCAG
                      ____________________________________________________________
consensus CACTATACAAAACAACTTTGAGTGTGCAGGATGGGGAGCTTCCTGTGCTTCCGTTATCAG
 
. : . : . : . : . : . :
rJMSF041G24+ TTTATGGTGCAGTTGCCATGGCACACAGTGATGTTTCCGAGGAGTACTCATCACCAAGCC
rJMSF032H14+ TTTATGGTGCAGTTGCCATGGCACACAGTGATGTTTCCGAGGAGTACTCATCACCAAGCC
                      ____________________________________________________________
consensus TTTATGGTGCAGTTGCCATGGCACACAGTGATGTTTCCGAGGAGTACTCATCACCAAGCC
 
. : . : . : . : . : . :
rJMSF041G24+ AGTTTTTCTTTTATCTTTATGACAAGAGAAATTCTGGCCTAGGAGGCATATCTTTTGAAG
rJMSF032H14+ AGTTTTTCTTTTATCTTTATGACAAGAGAAATTCTGGCCTAGGAGGCATATCTTTTGAAG
                      ____________________________________________________________
consensus AGTTTTTCTTTTATCTTTATGACAAGAGAAATTCTGGCCTAGGAGGCATATCTTTTGAAG
 
. : . : . : . : . : . :
rJMSF041G24+ AAGGTCAATTTTCTGTCTTCGGATATACCACTGCTGGAAGAGAAATTCTTTCTCAGATTA
rJMSF032H14+ AAGGTCAATTTTCTGTCTTCGGATATACCACTGCTGGAAGAGAAATTCTTTCTCAGATTA
JMFN036C12- GATATACCACTACTGGAAGAGAAATTCTTTCTCAGATTA
                      ____________________________________________________________
consensus AAGGTCAATTTTCTGTCTTCGGATATACCACTGCTGGAAGAGAAATTCTTTCTCAGATTA
 
. : . : . : . : . : . :
rJMSF041G24+ AAACTGGAGATGTGATTCGATCTGCAAAGCTCGTGGAAGGCCAAGATCGCCTCGTTCTAC
rJMSF032H14+ AAACTGGAGATGTGATTCGATCTGCAAAGCTCGTGGAAGGCCAAGATCGCCTCGTTCTAC
JMFN036C12- AAACTGGAGATGTGATTTGATCTGCAAAGCTCGTGGAAGGCCAAGATCGCCTCGTTTTAC
                      ____________________________________________________________
consensus AAACTGGAGATGTGATTCGATCTGCAAAGCTCGTGGAAGGCCAAGATCGCCTCGTTCTAC
 
. : . : . : . : . : . :
rJMSF041G24+ CAAAAGAGAGTTTGTAAAATCT
rJMSF032H14+ CAAAAGAGAGTTTGTAAAATCT
JMFN036C12- CAAAAGAGAGTTTATAAAATCTGCATATTTAGCCTCTCCCCTTCCTCTGGATAGTAGCCA
                      ____________________________________________________________
consensus CAAAAGAGAGTTTGTAAAATCTGCATATTTAGCCTCTCCCCTTCCTCTGGATAGTAGCCA
 
. : . : . : . : . : . :
JMFN036C12- ACTTTGTCATGTTTTGATGATCTATATATTTCAAACTTACCAGCTGAACATCATCCTCCC
                      ____________________________________________________________
consensus ACTTTGTCATGTTTTGATGATCTATATATTTCAAACTTACCAGCTGAACATCATCCTCCC
 
. : . : . : . : . : . :
JMFN036C12- TCGCCGTCCTGTTCTAACACTCTCCGGCGGAAGCGACCTTGGACTCAATTATGTCGGAGA
                      ____________________________________________________________
consensus TCGCCGTCCTGTTCTAACACTCTCCGGCGGAAGCGACCTTGGACTCAATTATGTCGGAGA
 
. : . : . : . : . : . :
JMFN036C12- AGCGGTGGTTGGGGATTTCCGGCGGACTGGACTTGTTTGCAACACGGGAAAGAATGGCAG
                      ____________________________________________________________
consensus AGCGGTGGTTGGGGATTTCCGGCGGACTGGACTTGTTTGCAACACGGGAAAGAATGGCAG
 
. : . : . : . : . : . :
JMFN036C12- CAAACCGATCAACATCTTGGGATAACAGATCAAAATTTTCATCACCACTGCAATTGGATG
                      ____________________________________________________________
consensus CAAACCGATCAACATCTTGGGATAACAGATCAAAATTTTCATCACCACTGCAATTGGATG
 
. : . : . : . : . : . :
JMFN036C12- GTTAGCGAATCCATCCCTCAACTTCGCTAACCTCTTAGGCCAGCTCAGTGAATGCTCCTC
                      ____________________________________________________________
consensus GTTAGCGAATCCATCCCTCAACTTCGCTAACCTCTTAGGCCAGCTCAGTGAATGCTCCTC
 
. : . : . : . : . : . :
JMFN036C12- CACCAAGTGAAGAGCGGCAATTTATATCCTACACCACAGCGCGCGTTGCATTATGCGCCC
                      ____________________________________________________________
consensus CACCAAGTGAAGAGCGGCAATTTATATCCTACACCACAGCGCGCGTTGCATTATGCGCCC
 
. : . : . : . : . : . :
JMFN036C12- AGATGCAAAACGACGTCGTTTTAATTATTTTTTTTTTTGAAATTTCCCGCCCCAGTGAAT
                      ____________________________________________________________
consensus AGATGCAAAACGACGTCGTTTTAATTATTTTTTTTTTTGAAATTTCCCGCCCCAGTGAAT
 
. : . : . : . : . : . :
JMFN036C12- GGCAGTAGTTTTTTCTTTAAAAAAAAACCCGCTGGTTCAGAATGTACATAATGTTATACT
                      ____________________________________________________________
consensus GGCAGTAGTTTTTTCTTTAAAAAAAAACCCGCTGGTTCAGAATGTACATAATGTTATACT