Previous Contig 002656:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008N14Sequence601002656 (3)631002656 (3)
JMFN035M15Sequence629002656 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF008N14- TATTTGCCTATTATAATCCATGCCCACCCCAAAGAATATATGGGCTTCTATTGCC
                      ____________________________________________________________
consensus TATTTGCCTATTATAATCCATGCCCACCCCAAAGAATATATGGGCTTCTATTGCC
 
. : . : . : . : . : . :
rJMFF008N14- AGCAAGTGATTTTATTACAAATCCATAATACAAAGGTGATATGTCAATGTTACATATGTG
                      ____________________________________________________________
consensus AGCAAGTGATTTTATTACAAATCCATAATACAAAGGTGATATGTCAATGTTACATATGTG
 
. : . : . : . : . : . :
rJMFF008N14- CTTTTAACAATCAATTGAACAGCATAACCACTAACCAGCCATCTCAATCACTGACTTATC
                      ____________________________________________________________
consensus CTTTTAACAATCAATTGAACAGCATAACCACTAACCAGCCATCTCAATCACTGACTTATC
 
. : . : . : . : . : . :
rJMFF008N14- TAATGCAAATCACTTCCATCTCTTGAAGAACTTATGCTTTCCGAATACACCATGTTTCCA
JMFF008N14+ GAACTTATGCTTTCCGAATACACCATGTTTCCA
JMFN035M15+ GAACTTATGCTTTCCGAATACACCATGTTTCCA
                      ____________________________________________________________
consensus TAATGCAAATCACTTCCATCTCTTGAAGAACTTATGCTTTCCGAATACACCATGTTTCCA
 
. : . : . : . : . : . :
rJMFF008N14- ACGCTTTCCAAACTTGCCATGCTTGAACTTGCCGTGCTTATACTTTCCATGGTGATGGCC
JMFF008N14+ ACGCTTTCCAAACTTGCCATGCTTGAACTTGCCGTGCTTATACTTTCCATGGTGATGGCC
JMFN035M15+ ACGCTTTCCAAACTTGCCATGCTTGAACTTGCCGTGCTTATACTTTCCATGGTGATGGCC
                      ____________________________________________________________
consensus ACGCTTTCCAAACTTGCCATGCTTGAACTTGCCGTGCTTATACTTTCCATGGTGATGGCC
 
. : . : . : . : . : . :
rJMFF008N14- AAACCCAACATGATGGCCATGCGCGAGATGGTGAGCTCCATAAGCAACAGCTGCAGCTGC
JMFF008N14+ AAACCCAACATGATGGCCATGCGCGAGATGGTGAGCTCCATAAGCAACAGCTGCAGCTGC
JMFN035M15+ AAACCCAACATGATGGCCATGCGCGAGATGGTGAGCTCCATAAGCAACAGCTGCAGCTGC
                      ____________________________________________________________
consensus AAACCCAACATGATGGCCATGCGCGAGATGGTGAGCTCCATAAGCAACAGCTGCAGCTGC
 
. : . : . : . : . : . :
rJMFF008N14- TGCACCTCCGGCTACCATTGCCCCGACATTAGGTCCATGCCCACCATGATGATAAGAAGC
JMFF008N14+ TGCACCTCCGGCTACCATTGCCCCGACATTAGGTCCATGCCCACCATGATGATAAGAAGC
JMFN035M15+ TGCACCTCCGGCTACCATTGCCCCGACATTAGGTCCATGC---CCATGATGATAAGAAGC
                      ____________________________________________________________
consensus TGCACCTCCGGCTACCATTGCCCCGACATTAGGTCCATGCCCACCATGATGATAAGAAGC
 
. : . : . : . : . : . :
rJMFF008N14- TGAAGGAGCTGGATAGCCTGCCGGATGATAACCTCCCGGGGGATATCCGCTAGGCGGGGG
JMFF008N14+ TGAAGGAGCTGGATAGCCTGCCGGATGATAACCTCCCGGGGGATATCCGCTAGGCGGGGG
JMFN035M15+ TGAAGGAGCTGGATAGCCTGCCGGATGATAACCTCCCGGGGGATATCCGCTAGGCGGGGG
                      ____________________________________________________________
consensus TGAAGGAGCTGGATAGCCTGCCGGATGATAACCTCCCGGGGGATATCCGCTAGGCGGGGG
 
. : . : . : . : . : . :
rJMFF008N14- ATATGCATATGCTGGCGGAGGATATGAGGTTGGAGGCGGGGGATATCCTGCGTGAGGGTA
JMFF008N14+ ATATGCATATGCTGGCGGAGGATATGAGGTTGGAGGCGGGGGATATCCTGCGTGAGGGTA
JMFN035M15+ ATATGCATATGCTGGCGGAGGATATGAGGTTGGAGGCGGGGGATATCCTGCGTGAGGGTA
                      ____________________________________________________________
consensus ATATGCATATGCTGGCGGAGGATATGAGGTTGGAGGCGGGGGATATCCTGCGTGAGGGTA
 
. : . : . : . : . : . :
rJMFF008N14- TCCAGCTGGAGGAGGATA-CCAGCAGGAGGTGGGTATCCTGGTGGGGGATAAGCACCATG
JMFF008N14+ TCCAGCTGGAGGAGGATA-CCAGCAGGAGGTGGGTATCCTGGTGGGGGATAAGCACCAT-
JMFN035M15+ TCCAGCTGGAGGAGGATAGCCAGCAGGAGGTGGGTATCCTGGTGGGGGATAAGCACCAT-
                      ____________________________________________________________
consensus TCCAGCTGGAGGAGGATA-CCAGCAGGAGGTGGGTATCCTGGTGGGGGATAAGCACCAT-
 
. : . : . : . : . : . :
rJMFF008N14- GGTGTGGAGGGTAATGTCCCATTGCATATCCAGCCAG
JMFF008N14+ GGTGTGGAGGGTAATGTCCCATTGCATATCCAGCCAGATTAGAAAAGAGTCCTCTGTCAT
JMFN035M15+ GGTGTGGAGGGTAATGTCCCATTGCATATCCAGCCAGATTAGAAAAGAGTCCTCTGTCAT
                      ____________________________________________________________
consensus GGTGTGGAGGGTAATGTCCCATTGCATATCCAGCCAGATTAGAAAAGAGTCCTCTGTCAT
 
. : . : . : . : . : . :
JMFF008N14+ CACTGTGCTGCTTGTCTTTTCCCATCTTTCTTCAACTCAACAGGATTCGATTCCACGAGG
JMFN035M15+ CACTGTGCTGCTTGTCTTTTCCCATCTTTCTTCAACTCAACAGGATTCGATTCCACAAGG
                      ____________________________________________________________
consensus CACTGTGCTGCTTGTCTTTTCCCATCTTTCTTCAACTCAACAGGATTCGATTCCACGAGG
 
. : . : . : . : . : . :
JMFF008N14+ AGTTGCTGCAATCTTTGGCTTCAAAACCTCTATAACAGTATAATCTCTTTATTTTCGCGT
JMFN035M15+ AGTTGCTGCAATCTTTGGCTTCAAAACCTCTATAACAGTATAATCTCTTTATTTTCGCGT
                      ____________________________________________________________
consensus AGTTGCTGCAATCTTTGGCTTCAAAACCTCTATAACAGTATAATCTCTTTATTTTCGCGT
 
. : . : . : . : . : . :
JMFF008N14+ TGCCTCTACGTCTCTTTCTTAATTAAGTT
JMFN035M15+ TGCCTCTACGTCTCTTTCTTAATTAAGTTATCTTTCTTTTTCCATTATTGCTTCCTTTTC
                      ____________________________________________________________
consensus TGCCTCTACGTCTCTTTCTTAATTAAGTTATCTTTCTTTTTCCATTATTGCTTCCTTTTC