Previous Contig 002655:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN025M17Sequence461002655 (2)gb:AX191860_14637491e-31Sequence 12 from Patent WO0149833.>gb:AF210061_1777329 Forsythia x intermedia di
JMFN035M06Sequence594002655 (2)gb:AX191953_14637771e-63Sequence 105 from Patent WO0149833.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN025M17+ AAAAGT
                      ____________________________________________________________
consensus AAAAGT
 
. : . : . : . : . : . :
JMFN025M17+ AACTCTTCAATTTTATTCCAAATTTTGTTACCTTGGAAAACACAGAGAAATAGGCACAGA
                      ____________________________________________________________
consensus AACTCTTCAATTTTATTCCAAATTTTGTTACCTTGGAAAACACAGAGAAATAGGCACAGA
 
. : . : . : . : . : . :
JMFN025M17+ CATACAAAGGTAGTCATCGGACGAGGCTAACATTGTACCACATAAGTTGTGCCGTACGTA
                      ____________________________________________________________
consensus CATACAAAGGTAGTCATCGGACGAGGCTAACATTGTACCACATAAGTTGTGCCGTACGTA
 
. : . : . : . : . : . :
JMFN025M17+ CGCATACATATAACTTGTTTTCATAAATATGAAAAAGGCAATTATATTGAAACCCTATTT
                      ____________________________________________________________
consensus CGCATACATATAACTTGTTTTCATAAATATGAAAAAGGCAATTATATTGAAACCCTATTT
 
. : . : . : . : . : . :
JMFN025M17+ TACAATTATAGGGTGTGGACTATGAAATTATATTTCACTACCAGCACTCGTAGAATTTGA
                      ____________________________________________________________
consensus TACAATTATAGGGTGTGGACTATGAAATTATATTTCACTACCAGCACTCGTAGAATTTGA
 
. : . : . : . : . : . :
JMFN025M17+ TATCCACGCGAAGTCTGAAATAAACCTCGCCTTCAAAGGCGTCGGTCATGACGGTGGCGA
JMFN035M06+ CGCGAAGTCTGAAATAAACCTCGCCTTCAAGAGCGTCGGTCATGACGGTGGCGA
                      ____________________________________________________________
consensus TATCCACGCGAAGTCTGAAATAAACCTCGCCTTCAAGGGCGTCGGTCATGACGGTGGCGA
 
. : . : . : . : . : . :
JMFN025M17+ CGCCGCGGTGCATGAAGAAGTCGCCGGTGCCACCCACCACCGATATATCCCTAGTCTTAT
JMFN035M06+ CGCCGCGGTGCATGAAGAAGTCGCCGGTGCCACCCACCACCGATATATCCCTAGTCTTAT
                      ____________________________________________________________
consensus CGCCGCGGTGCATGAAGAAGTCGCCGGTGCCACCCACCACCGATATATCCCTAGTCTTAT
 
. : . : . : . : . : . :
JMFN025M17+ TCATCAATGGGTCTGCGCCAATGAAATTTATGCTCCCTTGAGAATCCGTAGTGTTAAGCA
JMFN035M06+ TCATCAATGGGTCTGCGCCAATGAAATTTATGCTCCCTTGAGAATCCGTAGTGTTAAGCA
                      ____________________________________________________________
consensus TCATCAATGGGTCTGCGCCAATGAAATTTATGCTCCCTTGAGAATCCGTAGTGTTAAGCA
 
. : . : . : . : . : . :
JMFN025M17+ CAAAAGAGAACCCAAGCCAAGCCGTGTAAGTATTC
JMFN035M06+ CAAAAGAGAACCCAAGCCAAGCCGTGTAAGTATTCTTGGTGTCGTACATGTACATCCCTT
                      ____________________________________________________________
consensus CAAAAGAGAACCCAAGCCAAGCCGTGTAAGTATTCTTGGTGTCGTACATGTACATCCCTT
 
. : . : . : . : . : . :
JMFN035M06+ GGGCCCTCCCCACCGGCGTGGAGTGGAAGTTGTTGTCTAAAGTGATGGGGTCGTCGAAAA
                      ____________________________________________________________
consensus GGGCCCTCCCCACCGGCGTGGAGTGGAAGTTGTTGTCTAAAGTGATGGGGTCGTCGAAAA
 
. : . : . : . : . : . :
JMFN035M06+ CGACGACGTTGCCGAAGTGGAACTGGGTGGCGAGGATGGTGTAGTTGCCCCACTGCGGGG
                      ____________________________________________________________
consensus CGACGACGTTGCCGAAGTGGAACTGGGTGGCGAGGATGGTGTAGTTGCCCCACTGCGGGG
 
. : . : . : . : . : . :
JMFN035M06+ CTCCGACAATGGTGGAGGTGGCGTTAGCGGCGTTTTGGCCGTTGTAGATGACGTCGTGGA
                      ____________________________________________________________
consensus CTCCGACAATGGTGGAGGTGGCGTTAGCGGCGTTTTGGCCGTTGTAGATGACGTCGTGGA
 
. : . : . : . : . : . :
JMFN035M06+ AGTACAAGACTAGGTTCTTGCATGGCTTGTATGGCTTCTTCCTGCCCATTGGGTGTGTAG
                      ____________________________________________________________
consensus AGTACAAGACTAGGTTCTTGCATGGCTTGTATGGCTTCTTCCTGCCCATTGGGTGTGTAG
 
. : . : . : . : . : . :
JMFN035M06+ AGGAGACTGAAATTAGGAAGAAAAAGAGGCAAAAAAGAGTGAAAATATTGGGATTTCTTG
                      ____________________________________________________________
consensus AGGAGACTGAAATTAGGAAGAAAAAGAGGCAAAAAAGAGTGAAAATATTGGGATTTCTTG
 
. : . : . : . : . : . :
JMFN035M06+ ATGTTGTCATTTTCTTAGCACTAAAAAGAAAGGGTATAAAGTTTGTAGTAGTAAGCCTCG
                      ____________________________________________________________
consensus ATGTTGTCATTTTCTTAGCACTAAAAAGAAAGGGTATAAAGTTTGTAGTAGTAAGCCTCG