Previous Contig 002642:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010B10Sequence459002642 (12)pir|D84620|D846203e-35hypothetical protein At2g23090 [imported] - Arabidopsis thaliana>gb:AC004401_153433002642 (12)pir|D84620|D846203e-35hypothetical protein At2g23090 [imported] - Arabidopsis thaliana>gb:AC004401_153
JMFF011M13Sequence426002642 (12)pir|D84620|D846208e-35hypothetical protein At2g23090 [imported] - Arabidopsis thaliana>gb:AC004401_153
JMFF013A03Sequence438002642 (12)pir|D84620|D846203e-35hypothetical protein At2g23090 [imported] - Arabidopsis thaliana>gb:AC004401_153
JMFF022E08Sequence466002642 (12)pir|D84620|D846203e-35hypothetical protein At2g23090 [imported] - Arabidopsis thaliana>gb:AC004401_153438002642 (12)pir|D84620|D846203e-35hypothetical protein At2g23090 [imported] - Arabidopsis thaliana>gb:AC004401_153
JMFF022N24Sequence447002642 (12)pir|D84620|D846203e-35hypothetical protein At2g23090 [imported] - Arabidopsis thaliana>gb:AC004401_153424002642 (12)pir|D84620|D846203e-35hypothetical protein At2g23090 [imported] - Arabidopsis thaliana>gb:AC004401_153
JMFF023D04Sequence475002642 (12)pir|D84620|D846203e-35hypothetical protein At2g23090 [imported] - Arabidopsis thaliana>gb:AC004401_153450002642 (12)pir|D84620|D846203e-35hypothetical protein At2g23090 [imported] - Arabidopsis thaliana>gb:AC004401_153
JMFN025M14Sequence460002642 (12)pir|D84620|D846203e-35hypothetical protein At2g23090 [imported] - Arabidopsis thaliana>gb:AC004401_153
JMFN034P20Sequence439002642 (12)pir|D84620|D846203e-35hypothetical protein At2g23090 [imported] - Arabidopsis thaliana>gb:AC004401_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF022N24+ CCCCGTTCCGAAGGTCGGGAAGAGGAGAGAATCATATTTCATATCATT
rJMFF013A03+ GTTCCGAAGGTCGGGAAGAGGAGAGAATCATATTTCATATCATT
rJMFF011M13+ CCCCGTTCCGAAGGTCGGGAAGAGGAGAGAATCATATTTCATATCATT
JMFF023D04- CCCCGTTCCGAAGGTCGGGAAGAGGAGAGAATCATATTTCATATCATT
JMFF022N24- CCCCGTTCCGAAGGTCGGGAAGAGGAGAGAATCATATTTCATATCATT
rJMFF023D04+ CCCCGTTCCGAAGGTCGGGAAGAGGAGAGAATCATATTTCATATCATT
rJMFF022E08+ GAAGGTCGGGAAGAGGAGAGAATCATATTTCATATCATT
rJMFF010B10+ AAGAGGAGAGAATCATATTTCATATCATT
JMFF022E08- GAAGGTCGGGAAGAGGAGAGAATCATATTTCATATCATT
JMFF010B10- AAGAGGAGAGAATCATATTTCATATCATT
JMFN025M14- TTCCGAAGGTCGGGAAGAGGAGAGAATCATATTTCATATCATT
JMFN034P20- GAATCATATTTCATATCATT
                      ____________________________________________________________
consensus CCCCGTTCCGAAGGTCGGGAAGAGGAGAGAATCATATTTCATATCATT
 
. : . : . : . : . : . :
rJMFF022N24+ AGGGTCTCAGGCCAACGCAACCATGGGCGGCGGAAACGCTCAGAAATCTAAGATGGCTCG
rJMFF013A03+ AGGGTCTCAGGCCAACGCAACCATGGGCGGCGGAAACGCTCAGAAATCTAAGATGGCTCG
rJMFF011M13+ AGGGTCTCAGGCCAACGCAACCATGGGCGGCGGAAACGCTCAGAAATNTAAGATGGCTCG
JMFF023D04- AGGGTCTCAGGCCAACGCAACCATGGGCGGCGGAAACGCTCAGAAATCTAAGATGGCTCG
JMFF022N24- AGGGTCTCAGGCCAACGCAACCATGGGCGGCGGAAACGCTCAGAAATCTAAGATGGCTCG
rJMFF023D04+ AGGGTCTCAGGCCAACGCAACCATGGGCGGCGGAAACGCTCAGAAATCTAAGATGGCTCG
rJMFF022E08+ AGGGTCTCAGGCCAACGCAACCATGGGCGGCGGAAACGCTCAGAAATCTAAGATGGCTCG
rJMFF010B10+ AGGGTCTCAGGCCAACGCAACCATGGGCGGCGGAAACGCTCAGAAATCTAAGATGGCTCG
JMFF022E08- AGGGTCTCAGGCCAACGCAACCATGGGCGGCGGAAACGCTCAGAAATCTAAGATGGCTCG
JMFF010B10- AGGGTCTCAGGCCAACGCAACCATGGGCGGCGGAAACGCTCAGAAATCTAAGATGGCTCG
JMFN025M14- AGGGTCTCAGGCCAACGCAACCATGGGCGGCGGAAACGCTCAGAAATCTAAGATGGCTCG
JMFN034P20- AGGGTCTCAGGCCAACGCAACCATGGGCGGCGGAAACGCTCAGAAATCTAAGATGGCTCG
                      ____________________________________________________________
consensus AGGGTCTCAGGCCAACGCAACCATGGGCGGCGGAAACGCTCAGAAATCTAAGATGGCTCG
 
. : . : . : . : . : . :
rJMFF022N24+ CGAGAAGAATCTCGAGAAGATGAAAGCAGCCGGGAAAGGAAGTCAGCTGGAAAGCAACAA
rJMFF013A03+ CGAGAAGAATCTCGAGAAGATGAAAGCAGCCGGGAAAGGAAGTCAGCTGGAAAGCAACAA
rJMFF011M13+ CGAGAAGAATCTCGAGAAGATGAAAGCAGCCGGGAAAGGAAGTCAGCTGGAAAGCAACAA
JMFF023D04- CGAGAAGAATCTCGAGAAGATGAAAGCAGCCGGGAAAGGAAGTCAGCTGGAAAGCAACAA
JMFF022N24- CGAGAAGAATCTCGAGAAGATGAAAGCAGCCGGGAAAGGAAGTCAGCTGGAAAGCAACAA
rJMFF023D04+ CGAGAAGAATCTCGAGAAGATGAAAGCAGCCGGGAAAGGAAGTCAGCTGGAAAGCAACAA
rJMFF022E08+ CGAGAAGAATCTCGAGAAGATGAAAGCAGCCGGGAAAGGAAGTCAGCTGGAAAGCAACAA
rJMFF010B10+ CGAGAAGAATCTCGAGAAGATGAAAGCAGCCGGGAAAGGAAGTCAGCTGGAAAGCAACAA
JMFF022E08- CGAGAAGAATCTCGAGAAGATGAAAGCAGCCGGGAAAGGAAGTCAGCTGGAAAGCAACAA
JMFF010B10- CGAGAAGAATCTCGAGAAGATGAAAGCAGCCGGGAAAGGAAGTCAGCTGGAAAGCAACAA
JMFN025M14- CGAGAAGAATCTCGAGAAGATGAAAGCAGCCGGGAAAGGAAGTCAGCTGGAAAGCAACAA
JMFN034P20- CGAGAAGAATCTCGAGAAGATGAAAGCAGCCGGGAAAGGAAGTCAGCTGGAAAGCAACAA
                      ____________________________________________________________
consensus CGAGAAGAATCTCGAGAAGATGAAAGCAGCCGGGAAAGGAAGTCAGCTGGAAAGCAACAA
 
. : . : . : . : . : . :
rJMFF022N24+ GAAGGCCATGAATATCCAGTGCAAAGTGTGTATGCAGACATTTATGTGCACAACATCAGA
rJMFF013A03+ GAAGGCCATGAATATCCAGTGCAAAGTGTGTATGCAGACATTTATGTGCACAACATCAGA
rJMFF011M13+ GAAGGCCATGAATATCCAGTGCAAAGTGTGTATGCAGACATTTATGTGCACAACATCAGA
JMFF023D04- GAAGGCCATGAATATCCAGTGCAAAGTGTGTATGCAGACATTTATGTGCACAACATCAGA
JMFF022N24- GAAGGCCATGAATATCCAGTGCAAAGTGTGTATGCAGACATTTATGTGCACAACATCAGA
rJMFF023D04+ GAAGGCCATGAATATCCAGTGCAAAGTGTGTATGCAGACATTTATGTGCACAACATCAGA
rJMFF022E08+ GAAGGCCATGAATATCCAGTGCAAAGTGTGTATGCAGACATTTATGTGCACAACATCAGA
rJMFF010B10+ GAAGGCCATGAATATCCAGTGCAAAGTGTGTATGCAGACATTTATGTGCACAACATCAGA
JMFF022E08- GAAGGCCATGAATATCCAGTGCAAAGTGTGTATGCAGACATTTATGTGCACAACATCAGA
JMFF010B10- GAAGGCCATGAATATCCAGTGCAAAGTGTGTATGCAGACATTTATGTGCACAACATCAGA
JMFN025M14- GAAGGCCATGAATATCCAGTGCAAAGTGTGTATGCAGACATTTATGTGCACAACATCAGA
JMFN034P20- GAAGGCCATGAATATCCAGTGCAAAGTGTGTATGCAGACATTTATGTGCACAACATCAGA
                      ____________________________________________________________
consensus GAAGGCCATGAATATCCAGTGCAAAGTGTGTATGCAGACATTTATGTGCACAACATCAGA
 
. : . : . : . : . : . :
rJMFF022N24+ GGTGAAGTGCAGGGAACATGCTGAAGCGAAACACCCCAAGGCTGATGTTTCTACTTGTTT
rJMFF013A03+ GGTGAAGTGCAGGGAACATGCTGAAGCGAAACACCCCAAGGCTGATGTTTCTACTTGTTT
rJMFF011M13+ GGTGAAGTGCAGGGAACATGCTGAAGCGAAACACCCCAAGGCTGATGTTTCTACTTGTTT
JMFF023D04- GGTGAAGTGCAGGGAACATGCTGAAGCGAAACACCCCAAGGCTGATGTTTCTACTTGTTT
JMFF022N24- GGTGAAGTGCAGGGAACATGCTGAAGCGAAACACCCCAAGGCTGATGTTTCTACTTGTTT
rJMFF023D04+ GGTGAAGTGCAGGGAACATGCTGAAGCGAAACACCCCAAGGCTGATGTTTCTACTTGTTT
rJMFF022E08+ GGTGAAGTGCAGGGAACATGCTGAAGCGAAACACCCCAAGGCTGATGTTTCTACTTGTTT
rJMFF010B10+ GGTGAAGTGCAGGGAACATGCTGAAGCGAAACACCCCAAGGCTGATGTTTCTACTTGTTT
JMFF022E08- GGTGAAGTGCAGGGAACATGCTGAAGCGAAACACCCCAAGGCTGATGTTTCTACTTGTTT
JMFF010B10- GGTGAAGTGCAGGGAACATGCTGAAGCGAAACACCCCAAGGCTGATGTTTCTACTTGTTT
JMFN025M14- GGTGAAGTGCAGGGAACATGCTGAAGCGAAACACCCCAAGGCTGATGTTTCTACTTGTTT
JMFN034P20- GGTGAAGTGCAGGGAACATGCTGAAGCGAAACACCCCAAGGCTGATGTTTCTACTTGTTT
                      ____________________________________________________________
consensus GGTGAAGTGCAGGGAACATGCTGAAGCGAAACACCCCAAGGCTGATGTTTCTACTTGTTT
 
. : . : . : . : . : . :
rJMFF022N24+ TCCTCATCTCAAAAAGTGAAATATTTCTGTTGTTATAAACTATTTATAGATATGGTAATA
rJMFF013A03+ TCCTCATCTCAAAAAGTGAAATATTTCTGTTGTTATAAACTATTTATAGATATGGTAATA
rJMFF011M13+ TCCTCATCTCAAAAAGTGAAATATTTCTGTTGTTATAAACTATTTATAGATATGGTAATA
JMFF023D04- TCCTCATCTCAA
JMFF022N24- TCCTCATCTCAAAAAGTGAAATATTTCTGTTGTTATAAACTATTTATAGATATGGTAATA
rJMFF023D04+ TCCTCATCTCAAAAAGTGAAATATTTCTGTTGTTATAAACTATTTATAGATATGGTAATA
rJMFF022E08+ TCCTCATCTCAAAAAGTGAAATATTTCTGTTGTTATAAACTATTTATAGATATGGTAATA
rJMFF010B10+ TCCTCATCTCAAAAAGTGAAATATTTCTGTTGTTATAAACTATTTATAGATATGGTAATA
JMFF022E08- TCCTCATCTCAA
JMFF010B10- TCCTCATCTCAA
JMFN025M14- TCCTCATCTCAAAAAGTGAAATATTTCTGTTGTTATAAACTATTTATAGATATGGTAATA
JMFN034P20- TCCTCATCTCAAAAAGTGAAATATTTCTGTTGTTATAAACTATTTATAGATATGGTAATA
                      ____________________________________________________________
consensus TCCTCATCTCAAAAAGTGAAATATTTCTGTTGTTATAAACTATTTATAGATATGGTAATA
 
. : . : . : . : . : . :
rJMFF022N24+ TCTGTCACCTGTTTCAACTATGACAGTCCAAGCAAGTTATTGAATGTGCATTG-CATGGT
rJMFF013A03+ TCTGTCACCTGTTTCAACTATGACAGTCCAAGCAAGTTATTGAATGTGCATTG-CATGGT
rJMFF011M13+ TCTGTCACCTGTTTCAACTATGACAGTCCAAGCAAGTTATTGAATGTGCATTGCCANGGT
JMFF022N24- TCTGTCACCTGTTTCAACTATGACAGTCCAAGCAAGTTATTGAATGTGCATTG-CATGGT
rJMFF023D04+ TCTGTCACCTGTTTCAACTATGACAGTCCAAGCAAGTTATTGAATGTGCATTG-CATGGT
rJMFF022E08+ TCTGTCACCTGTTTCAACTATGACAGTCCAAGCAAGTTATTGAATGTGCATTG-CATGGT
rJMFF010B10+ TCTGTCACCTGTTTCAACTATGACAGTCCAAGCAAGTTATTGAATGTGCATTG-CATGGT
JMFN025M14- TCTGTCACCTGTTTCAACTATGACAGTCCAAGCAAGTTATTGAATGTGCATTG-CATGGT
JMFN034P20- TCTGTCACCTGTTTCAACTATGACAGTCCAAGCAAGTTATTGAATGTGCATTG-CATGGT
                      ____________________________________________________________
consensus TCTGTCACCTGTTTCAACTATGACAGTCCAAGCAAGTTATTGAATGTGCATTG-CATGGT
 
. : . : . : . : . : . :
rJMFF022N24+ TGTTTATGAGACTCCCA
rJMFF013A03+ TGTTTATGAGACTCCCAAGT
rJMFF011M13+ TGTTTATGAGACTCCCAA
JMFF022N24- TGTTTATGAGACTCCCAAGTTGTTTAAG
rJMFF023D04+ TGTTTATGAGACTCCCAAGTTGTTTAAGTGACAAATATATATA
rJMFF022E08+ TGTTTATGAGACTCCCAAGTTGTTTAAGTGACAAATATAT
rJMFF010B10+ TGTTTATGAGACTCCCAAGTTGTTTAAGTGACAAATATATAT
JMFN025M14- TGTTTATGAGACTCCCAAGTTGTTTAAGTGACAAATATATATATACATATTTTCATCC
JMFN034P20- TGTTTATGAGACTCCCAAGTTGTTTAAGTGACAAATATATATATACATATTTTCATCCAG
                      ____________________________________________________________
consensus TGTTTATGAGACTCCCAAGTTGTTTAAGTGACAAATATATATATACATATTTTCATCCAG