Previous Contig 002641:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006C04Sequence486002641 (5)gb:AF273333_17823495e-41Lycopersicon esculentum clone BAC 19, complete sequence.645002641 (5)gb:AF273333_17823496e-39Lycopersicon esculentum clone BAC 19, complete sequence.
JMFF013A19Sequence506002641 (5)gb:AF273333_17823491e-35Lycopersicon esculentum clone BAC 19, complete sequence.
JMFN019O04Sequence546002641 (5)gb:AF273333_17823497e-41Lycopersicon esculentum clone BAC 19, complete sequence.
JMFN034O24Sequence570002641 (5)gb:AF273333_17823498e-41Lycopersicon esculentum clone BAC 19, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF013A19- TATAAATTCAGAAATTCAAGTTGTCATTAGCAGGCTGAGAAAATATATGGTA
rJMFF006C04- TATAAATTCAGAAATTCAAGTTGTCATTAGCAGGCTGAGAAAATATAT-GTA
                      ____________________________________________________________
consensus TATAAATTCAGAAATTCAAGTTGTCATTAGCAGGCTGAGAAAATATATGGTA
 
. : . : . : . : . : . :
rJMFF013A19- TATTGAAGTTGAGCATANATTAAGGTAATTCCGAAACAAAATCGTAGTGTTATCGATTCA
rJMFF006C04- TATTGAAGTTGAGCATANATTAAGGTAATTCCGAAACAAAATCGTAGTGTTATCGATTCA
JMFN034O24+ CCGAAACAAAATCGTAGTGTTATCGATTCA
                      ____________________________________________________________
consensus TATTGAAGTTGAGCATANATTAAGGTAATTCCGAAACAAAATCGTAGTGTTATCGATTCA
 
. : . : . : . : . : . :
rJMFF013A19- AGTCAAGAATTAAATANAAACACTTATTTTTCCAACAACTACACCAGAGAATATCAACAA
rJMFF006C04- AGTCAAGAATTAAATANAAACACTTATTTTTCCAACAACTACACCAGAGAATATCAACAA
JMFF006C04+ GAATATCAACAA
JMFN034O24+ AGTCAAGAATTAAATAGAAACACTTATTTTTCCAACAACTACACCAGAGAATATCAACAA
                      ____________________________________________________________
consensus AGTCAAGAATTAAATAGAAACACTTATTTTTCCAACAACTACACCAGAGAATATCAACAA
 
. : . : . : . : . : . :
rJMFF013A19- TCAGGATCAGCATCAGCGGCCTTCCTCTAAAAGCCCTAATTGACAAATCGCANATGCANA
rJMFF006C04- TCAGGATCAGCATCAGCGGCCTTCCTCTAAAAGCCCTAATTGACAAATCGCANATGCANA
JMFF006C04+ TCAGGATCAGCATCAGCGGCCTTCCTCTAAAAGCCCTAATTGACAAATCGCAGATGCAGA
JMFN034O24+ TCAGGATCAGCATCAGCGGCCTTCCTCTAAAAGCCCTAATTGACAAATCGCAGATGCAGA
                      ____________________________________________________________
consensus TCAGGATCAGCATCAGCGGCCTTCCTCTAAAAGCCCTAATTGACAAATCGCAGATGCAGA
 
. : . : . : . : . : . :
rJMFF013A19- TGGATCCACCAATCTTTCAATCGGAATCATCACTGGACTCTTGTTCNAGGCGTTTAANAG
rJMFF006C04- TGGATCCACCAATCTTTCAATCGGAATCATCACTGGACTCTTGTTCNAGGCGTTTAANAG
JMFF006C04+ TGGATCCACCAATCTTTCAATCGGAATCATCACTGGACTCTTGTTCGAGGCGTTTAAGAG
JMFN034O24+ TGGATCCACCAATCTTTCAATCGGAATCATCACTGGACTCTTGTTCGAGGCGTTTAAGAG
                      ____________________________________________________________
consensus TGGATCCACCAATCTTTCAATCGGAATCATCACTGGACTCTTGTTCGAGGCGTTTAAGAG
 
. : . : . : . : . : . :
rJMFF013A19- CTTCACCGTGGGCCCAGGTCTCGATTGTGANATCGGGCTTGGCGTTAAGGCCGACGCCGA
rJMFF006C04- CTTCACCGTGGGCCCAGGTCTCGATTGTGANATCGGGCTTGGCGTTAAGGCCGACGCCGA
JMFN019O04+ TGGGCCCAGGTCTCGATTGTGAGATCGGGCTTGGCGTTAAGGCCGACGCCGA
JMFF006C04+ CTTCACCGTGGGCCCAGGTCTCGATTGTGAGATCGGGCTTGGCGTTAAGGCCGACGCCGA
JMFN034O24+ CTTCACCGTGGGCCCAGGTCTCGATTGTGAGATCGGGCTTGGCGTTAAGGCCGACGCCGA
                      ____________________________________________________________
consensus CTTCACCGTGGGCCCAGGTCTCGATTGTGAGATCGGGCTTGGCGTTAAGGCCGACGCCGA
 
. : . : . : . : . : . :
rJMFF013A19- GGATGACNATGGTGAGGAAGCTGGTGACGTAGCAGGGGAGCTCCCAATCCTCCCACTTGC
rJMFF006C04- GGATGACNATGGTGAGGAAGCTGGTGACGTAGCAGGGGAGCTCCCAATCCTCCCACTTGC
JMFN019O04+ GGATGACGATGGTGAGGAAGCTGGTGACGTAGCAGGGGAGCTCCCAATCCTCCCACTTGC
JMFF006C04+ GGATGACGATGGTGAGGAAGCTGGTGACGTAGCAGGGGAGCTCCCAATCCTCCCACTTGC
JMFN034O24+ GGATGACGATGGTGAGGAAGCTGGTGACGTAGCAGGGGAGCTCCCAATCCTCCCACTTGC
                      ____________________________________________________________
consensus GGATGACGATGGTGAGGAAGCTGGTGACGTAGCAGGGGAGCTCCCAATCCTCCCACTTGC
 
. : . : . : . : . : . :
rJMFF013A19- GGGACTGTCCGGGGGGCAGCGGGGTCCGGTTGAANAGGTAGCCGTTGGGGCGCTCCTGGT
rJMFF006C04- GGGACTGTCCGGGGGGCAGCGGGGTCCGGTTGAANAGGTAGCCGTTGGGGCGCTCCTGGT
JMFN019O04+ GGGACTGTCCGGGGGGCAGCGGGGTCCGGTTGAAGAGGTAGCCGTTGGGGCGCTCCTGGT
JMFF006C04+ GGGACTGTCCGGGGGGCAGCGGGGTCCGGTTGAAGAGGTAGCCGTTGGGGCGCTCCTGGT
JMFN034O24+ GGGACTGTCCGGGGGGCAGCGGGGTCCGGTTGAAGAGGTAGCCGTTGGGGCGCTCCTGGT
                      ____________________________________________________________
consensus GGGACTGTCCGGGGGGCAGCGGGGTCCGGTTGAAGAGGTAGCCGTTGGGGCGCTCCTGGT
 
. : . : . : . : . : . :
rJMFF013A19- GGCCGGGAGTGAGGAAAGGGTTGGGGCCATGGCC
rJMFF006C04- GGCCGGGAGTGAGGAAAGGGTTGGGGCCATGGCCTCCTCGCGTGCGGAGGCCGGAGCTCA
JMFN019O04+ GGCCGGGAGTGAGGAAAGGGTTGGGGCCATGGCCTCCTCGCGTGCGGAGGCCGGAGCTCA
JMFF006C04+ GGCCGGGAGTGAGGAAAGGGTTGGGGCCATGGCCTCCTCGCGTGCGGAGGCCGGAGCTCA
JMFN034O24+ GGCCGGGAGTGAGGAAAGGGTTGGGGCCATGGCCTCCTCGCGTGCGGAGGCCGGAGCTCA
                      ____________________________________________________________
consensus GGCCGGGAGTGAGGAAAGGGTTGGGGCCATGGCCTCCTCGCGTGCGGAGGCCGGAGCTCA
 
. : . : . : . : . : . :
rJMFF006C04- GGCGGGTTCTCAGCATACCGGCGGCGTTCGCGAAGGGTTTCGCGGATGGCATCTTTGATG
JMFN019O04+ GGCGGGTTCTCAGCATACCGGCGGCGTTCGCGAAGGGTTTCGCGGATGGCATCTTTGATG
JMFF006C04+ GGCGGGTTCTCAGCATACCGGCGGCGTTCGCGAAGGGTTTCGCGGATGGCATCTTTGATG
JMFN034O24+ GGCGGGTTCTCAGCATACCGGCGGCGTTCGCGAAGGGTTTCGCGGATGGCATCTTTGATG
                      ____________________________________________________________
consensus GGCGGGTTCTCAGCATACCGGCGGCGTTCGCGAAGGGTTTCGCGGATGGCATCTTTGATG
 
. : . : . : . : . : . :
rJMFF006C04- AAATTTGGAGAGAGTTTTTGTGTGGACTTGGAGATGGTCTTTGTAGTGTGGAGT
JMFN019O04+ AAATTTG
JMFF006C04+ AAATTTGGAGAGAGTTTTTGTGTGGACTTGGAGATGGTCTTTGTAGTGTGGAGT
JMFN034O24+ AAATTTGGAGAGAGTTTTTGTGTGGACTTGGAGATGGTCTTTGTAGTGTGGAGTGATGAA
                      ____________________________________________________________
consensus AAATTTGGAGAGAGTTTTTGTGTGGACTTGGAGATGGTCTTTGTAGTGTGGAGTGATGAA