Previous Contig 002636:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003J15Sequence601001014 (10)gb:CQ831406_14537137e-65Sequence 13 from Patent WO2004057003.410002636 (12)gb:CQ831406_14537131e-08Sequence 13 from Patent WO2004057003.
JMFF006A17Sequence510001014 (10)pir|T00716|T007162e-40L-allo-threonine aldolase homolog F22O13.11 - Arabidopsis thaliana836002636 (12)gb:CQ831406_14537137e-70Sequence 13 from Patent WO2004057003.
JMFF009H15Sequence436001014 (10)gb:CQ831406_14537133e-28Sequence 13 from Patent WO2004057003.797002636 (12)gb:CQ831406_14537135e-66Sequence 13 from Patent WO2004057003.
JMFF020D04Sequence435001014 (10)gb:CQ831406_14537137e-28Sequence 13 from Patent WO2004057003.762002636 (12)gb:CQ831406_14537131e-65Sequence 13 from Patent WO2004057003.
JMFF023B04Sequence496001014 (10)gb:CQ831406_14537132e-37Sequence 13 from Patent WO2004057003.736002636 (12)gb:CQ831406_14537133e-62Sequence 13 from Patent WO2004057003.
JMFF023G24Sequence685002636 (12)gb:CQ831406_14537132e-53Sequence 13 from Patent WO2004057003.
JMFF023J06Sequence463001014 (10)gb:CQ831406_14537132e-32Sequence 13 from Patent WO2004057003.788002636 (12)gb:CQ831406_14537136e-72Sequence 13 from Patent WO2004057003.
JMFF027L13Sequence615001014 (10)gb:CQ831406_14537134e-68Sequence 13 from Patent WO2004057003.464002636 (12)gb:CQ831406_14537132e-20Sequence 13 from Patent WO2004057003.
JMFF034N12Sequence513001014 (10)pir|T00716|T007162e-40L-allo-threonine aldolase homolog F22O13.11 - Arabidopsis thaliana796002636 (12)gb:CQ831406_14537132e-72Sequence 13 from Patent WO2004057003.
JMFF042J15Sequence640001014 (10)gb:CQ831406_14537131e-61Sequence 13 from Patent WO2004057003.644002636 (12)gb:CQ831406_14537138e-39Sequence 13 from Patent WO2004057003.
JMFF050M22Sequence586001014 (10)gb:CQ831406_14537138e-53Sequence 13 from Patent WO2004057003.603002636 (12)gb:CQ831406_14537135e-37Sequence 13 from Patent WO2004057003.
JMFN034K11Sequence610002636 (12)gb:CQ831406_14537134e-30Sequence 13 from Patent WO2004057003.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF023J06+ CAGCAGAGTATACAGACAAAGTTGGAG
rJMFF034N12+ CAGCAGAGTATACAGACAAAGTNGGAG
rJMFF006A17+ TGGTAGATGCNTCTCAGCAGAGTATACAGACAAAGTTGGAG
                      ____________________________________________________________
consensus TGGTAGATGCNTCTCAGCAGAGTATACAGACAAAGTTGGAG
 
. : . : . : . : . : . :
rJMFF023B04+ AAACTTCATATNGATGGAGCTCGCATATTCAATGCAT
rJMFF023J06+ AGCTCGCAAAGAAGTACGGGCTGAAACTTCATATTGATGGAGCTCGCATATTCAATGCAT
rJMFF034N12+ AGCTCGCAAAGAAGTACGGGCTGAAACTTCATATTGATGGAGCTCGCATATTCAATGCAT
rJMFF020D04+ CGCAAAGAAGTACGGGCTGAAACTTCATATTGATGGAGCTCGCATATTCAATGCAT
rJMFF006A17+ AGCTCGCAAAGAAGTACGGGCTGAAACTTCATATTGATGGAGCTCGCATATTCAATGCAT
rJMFF009H15+ AGCTCGCAAAGAAGTACGGGCTGAAACTTCATATTGATGGAGCTCGCATATTCAATGCAT
                      ____________________________________________________________
consensus AGCTCGCAAAGAAGTACGGGCTGAAACTTCATATTGATGGAGCTCGCATATTCAATGCAT
 
. : . : . : . : . : . :
rJMFF023B04+ CTGCTGCCCTTGGCGTTCCTGCTAGTAGGCTTGTACAGNCTGCCGATTCTGTTTCTGTTT
rJMFF023J06+ CTGCTGCCCTTGGCGTTCCTGCTAGTAGGCTTGTACAGGCTGCCGATTCTGTTTCTGTTT
rJMFF034N12+ CTGCTGCCCTTGGCGTTCCTGCTAGTAGGCTTGTACAGGCTGCCGATTCTGTTTCTGTTT
rJMFF020D04+ CTGCTGCCCTNGGCGTTCNTGCTAGTAGGCTTGTACAGGCTGCCGATTCTGTTTCTGTTT
rJMFF023G24+ CTAGTAGGCTTGTACAGGCTGCCGATTCTGTTTCTGTTT
rJMFF006A17+ CTGCTGCCCTTGGCGTTCCTGCTAGTAGGCTTGTACAGGCTGCCGATTCTGTTTCTGTTT
rJMFF009H15+ CTGCTGCCCTTGGCGTTCCTGCTAGTAGGCTTGTACAGGCTGCCGATTCTGTTTCTGTTN
                      ____________________________________________________________
consensus CTGCTGCCCTTGGCGTTCCTGCTAGTAGGCTTGTACAGGCTGCCGATTCTGTTTCTGTTT
 
. : . : . : . : . : . :
rJMFF023B04+ GTCTGTCAAAAGGTCTGGGCGCTCCAGTAGGAAGTGTAATTGTTGGTCCGAAAAGCTTCA
rJMFF023J06+ GTCTGTCAAAAGGTCTGGGCGCTCCAGTAGGAAGTGTAATTGTTGGTCCGAAAAGCTTCA
rJMFF034N12+ GTCTGTCAAAAGGTCTGGGCGCTCCAGTAGGAAGTGTAATTGTTGGTCCGAAAAGCTTCA
rJMFF020D04+ GTCTGTCAAAAGGTCTGGGCGCTCCAGTAGGAAGTGTAATTGTTGGTCCGAAAAGCTTCA
rJMFF023G24+ GTCTGTCAAAAGGTCTGGGCGCTCCAGTAGGAAGTGTAATTGTTGGTCCGAAAAGCTTCA
rJMFF006A17+ GTCTGTCAAAAGGTCTGGGCGCTCCAGTAGGAAGTGTAATTGTTGGTCCGAAAAGCTTCA
rJMFF009H15+ GTCTGTCAAAAGGTCTGGGCGCTCCAGTAGGAAGTGTAATTGTTGGTCCGAAAAGCTTCA
rJMFF042J15+ GAAAAGCTTCA
                      ____________________________________________________________
consensus GTCTGTCAAAAGGTCTGGGCGCTCCAGTAGGAAGTGTAATTGTTGGTCCGAAAAGCTTCA
 
. : . : . : . : . : . :
rJMFF023B04+ TTGACAGGGCAAGGATTATGAGAAAGACCTTAGGCGGTGGAATGAGACAGATAGGCGTGT
rJMFF023J06+ TTGACAGGGCAAGGATTATGAGAAAGACCTTAGGCGGTGGAATGAGACAGATAGGCGTGT
rJMFF034N12+ TTGACAGGGCAAGGATTATGAGAAAGACCTTAGGCGGTGGAATGAGACAGATAGGCGTGT
rJMFF020D04+ TTGACAGGGCAAGGATTATGAGAAAGACCTTAGGCGGTGGAATGAGACAGATAGGCGTGT
rJMFF023G24+ TTGACAGGGCAAGGATTATGAGAAAGACCTTAGGCGGTGGAATGAGACAGATAGGCGTGT
rJMFF006A17+ TTGACAGGGCAAGGATTATGAGAAAGACCTTAGGCGGTGGAATGAGACAGATAGGCGTGT
rJMFF050M22+ GGGCAAGGATTATGAGAAAGACCTTAGGCGGTGGAATGAGACAGATAGGCGTGT
rJMFF027L13+ CAAGGATTATGAGAAAGACNTNAGGCGGTGGAATGAGACAGATAGGCGTGT
rJMFF009H15+ TTGACAGGGCAAGGATTATGAGAAAGACCTTAGGCGGTGGAATGAGACAGATAGGCGTGT
rJMFF042J15+ TTGACAGGGCAAGGATTATGAGAAAGACCTTAGGCGGTGGAATGAGACAGATAGGCGTGT
JMFN034K11+ ATAGGCGTGT
                      ____________________________________________________________
consensus TTGACAGGGCAAGGATTATGAGAAAGACCTTAGGCGGTGGAATGAGACAGATAGGCGTGT
 
. : . : . : . : . : . :
rJMFF023B04+ TGTGTGCTGCTGCTCTTGTTGGGTTTCAAGAAAATGTCGGTAAGCTCGAAGGGGATCACA
rJMFF023J06+ TGTGTGCTGCTGCTCTTGTTGGGTTTCAAGAAAATGTCGGTAAGCTCGAAGGGGATCACA
rJMFF034N12+ TGTGTGCTGCTGCTCTTGTTGGGTTTCAAGAAAATGTCGGTAAGCTCGAAGGGGATCACA
rJMFF020D04+ TGTGTGCTGCTGCTCTTGTTGGGTTTCAAGAAAATGTCGGTAAGCTCGAAGGGGATCACA
rJMFF023G24+ TGTGTGCTGCTGCTCTTGTTGGGTTTCAAGAAAATGTCGGTAAGCTCGAAGGGGATCACA
rJMFF006A17+ TGTGTGCTGCTGCTCTTGTTGGGTTTCAAGAAAATGTCGGTAAGCTCGAAGGGGATCACA
rJMFF050M22+ TGTGTGCTGCTGCTCTTGTTGGGTTTCAAGAAAATGTCGGTAAGCTCGAAGGGGATCACA
rJMFF027L13+ --TGTTNTNCTGCTCTTGTTGGGTTTCAAGAAAATGTCGGTAAGCTNGAAGGGGATCACA
rJMFF009H15+ TGTGTGCTGCTGCTCTTGTTGGGTTTCAAGAAAATGTCGGTAAGCTCGAAGGGGATCACA
rJMFF042J15+ TGTGTGCTGCTGCTCTTGTTGGGTTTCAAGAAAATGTCGGTAAGCTCGAAGGGGATCACA
rJMFF003J15+ GAAGGGGATCACN
JMFN034K11+ TGTGTGCTGCTGCTCTTGTTGGGTTTCAAGAAAATGTCGGTAAGCTCGAAGGGGATCACA
                      ____________________________________________________________
consensus TGTGTGCTGCTGCTCTTGTTGGGTTTCAAGAAAATGTCGGTAAGCTCGAAGGGGATCACA
 
. : . : . : . : . : . :
rJMFF023B04+ AAAAGGCTAAAACTTTAGCAGAGGGGCTTAACAAAATTAGCGGACTGGAATTTGATATGG
rJMFF023J06+ AAAAGGCTAAAACTTTAGCAGAGGGGCTTAACAAAATTAGCGGACTGGAAGTTGATATGG
rJMFF034N12+ AAAAGGCTAAAACTTTAGCAGAGGGGCTTAACAAAATTAGCGGACTGGAAGTTGATATGG
rJMFF020D04+ AAAAGGCTAAAACTTTAGCAGAGGGGCTTAACAAAATTAGCGGACTGGAAGTTGATATGG
rJMFF023G24+ AAAAGGCTAAAACTTTAGCAGAGGGGCTTAACAAAATTAGCGGACTGGAAGTTGATATGG
rJMFF006A17+ AAAAGGCTAAAACTTTAGCAGAGGGGCTTAACAAAATTAGCGGACTGGAAGTTGATATGG
rJMFF050M22+ AAAAGGCTAAAACTTTAGCAGAGGGGCTTAACAAAATTAGCGGACTGGAAGTTGATATGG
rJMFF027L13+ AAAAGGNTAANACTTTAGCAGNGGGGNNTAACAAAATTAGCGGANTGGAAGTNGATATGG
rJMFF009H15+ AAAAGGCTAAAACTTTAGCAGAGGGGCTTAACAAAATTAGCGGACTGGAAGTTGATATGG
rJMFF042J15+ AAAAGGCTAAAACTTTAGCAGAGGGGCTTAACAAAATTAGCGGACTGGAAGTTGATATGG
rJMFF003J15+ ANAAGGNTAANACTTTAGCAGNGGGGNNTAACAANATTAGCGGNCTGGAAGNNGATANGG
JMFN034K11+ AAAAGGCTAAAACTTTAGCAGAGGGGCTTAACAAAATTAGCGGACTGGAAGTTGATATGG
                      ____________________________________________________________
consensus AAAAGGCTAAAACTTTAGCAGAGGGGCTTAACAAAATTAGCGGACTGGAAGTTGATATGG
 
. : . : . : . : . : . :
rJMFF023B04+ CTTCAGTAGAAACAAACATTGTATTCTGCGATATACTTAAGGAAGCAAACACAACTGAAA
rJMFF023J06+ CTTCAGTAGAAACAAACATTGTATTCTGCGATATACTTAAGGAAGCAAACACAACTGAAA
rJMFF034N12+ CTTCAGTAGAAACAAACATTGTATTCTGCGATATACTTAAGGAAGCAAACACAACTGAAA
rJMFF020D04+ CTTCAGTAGAAACAAACATNGTATTCTGCGATATACTTAAGGAAGCAAACACAACTGAAA
rJMFF023G24+ CTTCAGTAGAAACAAACATTGTATTCTGCGATATACTTAAGGAAGCAAACACAACTGAAA
rJMFF006A17+ CTTCAGTAGAAACAAACATTGTATTCTGCGATATACTTAAGGAAGCAA--ACAACTGAAA
rJMFF050M22+ CTTCAGTAGAAACAAACATTGTATTCTGCGATATACTTAAGGAAGCAAACACAACTGAAA
rJMFF027L13+ CTTCAGTAGAAACAANCATCGTATTNTNCGATATNCTTAAGGAAGCAANCACNACTGAAA
rJMFF009H15+ CTTCAGTAGAAACAAACATTGTATTCTGCGATATACTTAAGGAAGCAAACACAACTGAAA
rJMFF042J15+ CTTCAGTAGAAACAAACATTGTATTCTGCGATATACTTAAGGAAGCAAACACAACTGAAA
rJMFF003J15+ CTTCAGNAGAANCAACCATCGTATTNTNCGATATNCTTAAGGAAGCANNCACNACTGAAA
JMFN034K11+ CTTCAGTAGAAACAAACATTGTATTCTGCGATATACTTAAGGAAGCAAACACAACTGAAA
                      ____________________________________________________________
consensus CTTCAGTAGAAACAAACATTGTATTCTGCGATATACTTAAGGAAGCAAACACAACTGAAA
 
. : . : . : . : . : . :
rJMFF023B04+ TGGAGCTGTGCAAGAGGCTAGCGGAACATGGTGTGCTCATTCTACCAGAAGGCCCAAAGA
rJMFF023J06+ TGGAGCTGTGCAAGAGGCTAGCGGAACATGGTGTGCTCATTCTACCAGAAGGCCCAAAGA
rJMFF034N12+ TGGAGCTGTGCAAGAGGCTAGCGGAACATGGTGTGCTCATTCTACCAGAAGGCCCAAAGA
rJMFF020D04+ TGGAGCTGTGCAAGAGGCTAGCGGAACATGGTGTGCTCATTCTACCAGAAGGCCCAAAGA
rJMFF023G24+ TGGAGCTGTGCAAGAGGCTAGCGGAACATGGTGTGCTCATTCTACCAGAAGGCCCAAAGA
rJMFF006A17+ TGGAGCTGTGCAAGAGGCTAGCGGAACATGGTGTGCTCATTCTACCAGAAGGCCCAAAGA
rJMFF050M22+ TGGAGCTGTGCAAGAGGCTAGCGGAACATGGTGTGCTCATTCTACCAGAAGGCCCAAAGA
rJMFF027L13+ TGGAGCTGTGCAAGAGGCTAGCGGAACATNGTGTGNTCATTNTNCCAGNAGGCCCAAAGA
rJMFF009H15+ TGGAGCTGTGCAAGAGGCTAGCGGAACATGGTGTGCTCATTCTACCAGAAGGCCCAAAGA
rJMFF042J15+ TGGAGCTGTGCAAGAGGCTAGCGGAACATGGTGTGCTCATTCTACCAGAAGGCCCAAAGA
rJMFF003J15+ TGGAGCTGTGCAAGAGGCTAGCGGAACATNGTGTGNTCATTATTCCAGNAGGCCCAAAGA
JMFN034K11+ TGGAGCTGTGCAAGAGGCTAGCGGAACATGGTGTGCTCATTCTACCAGAAGGCCCAAAGA
                      ____________________________________________________________
consensus TGGAGCTGTGCAAGAGGCTAGCGGAACATGGTGTGCTCATTCTACCAGAAGGCCCAAAGA
 
. : . : . : . : . : . :
rJMFF023B04+ GAATCAGGTTCGTGATTCACCACCAGATTTCCGACACTGATGTGCAGTATGCATTATCCC
rJMFF023J06+ GAATCAGGTTCGTGATTCACCACCAGATTTCCGACACTGATGTGCAGTATGCATTATCCC
rJMFF034N12+ GAATCAGGTTCGTGATTCACCACCAGATTTCCGACACTGATGTGCAGTATGCATTATCCC
rJMFF020D04+ GAATCAGGTTCGTGATTCACCACCAGATTTCCGACACTGATGTGCAGTATGCATTATCCC
rJMFF023G24+ GAATCAGGTTCGTGATTCACCACCAGATTTCCGACACTGATGTGCAGTATGCATTATCCC
rJMFF006A17+ GAATCAGGTTCGTGATTCACCACCAGATTTCCGACACTGATGTGCAGTATGCATTATCCC
rJMFF050M22+ GAATCAGGTTCGTGATTCACCACCAGATTTCCGACACTGATGTGCAGTATGCATTATCCC
rJMFF027L13+ GAATCAGGTTNGTGATTCNCCACCAGATTTCCGACACNGATGNGCAGNANGCATNATCCC
rJMFF009H15+ GAATCAGGTTCGTGATTCACCACCAGATTTCCGACACTGATGTGCAGTATGCATTATCCC
rJMFF042J15+ GAATCAGGTTCGTGATTCACCACCAGATTTCCGACACTGATGTGCAGTATGCATTATCCC
rJMFF003J15+ GAATCAGNNTCGTGATTCNCCACCAGATTTCCGACNCNGATGNGCAGNANGCATNATCCN
JMFN034K11+ GAATCAGGTTCGTGATTCACCACCAGATTTCCGACACTGATGTGCAGTATGCATTATCCC
                      ____________________________________________________________
consensus GAATCAGGTTCGTGATTCACCACCAGATTTCCGACACTGATGTGCAGTATGCATTATCCC
 
. : . : . : . : . : . :
rJMFF023B04+ GAGTTCAGCGTGCTGTGACTGGAGTGGCAAATGGAAGCGGGGACCANTGAAATTGAGGGA
rJMFF023J06+ GAGTTCAGCGTGCTGTGACTGGAGTGGCAAATGGAAGCGGGGACCATTGAAATTGAGGGA
rJMFF034N12+ GAGTTCAGCGTGCTGTGACTGGAGTGGCAAATGGAAGCGGGGACCATTGAAATTGAGGGA
rJMFF020D04+ GAGTTCAGCGTGCTGTGACTGGAGTGGCAAATGGAAGCGGGGACCATTGAAATTGAGGGA
rJMFF023G24+ GAGTTCAGCGTGCTGTGACTGGAGTGGCAAATGGAAGCGGGGACCATNGAAATTGAGGGA
rJMFF006A17+ GAGTTCAGCGTGCTGTGACTGGAGTGGCAAATGGAAGCGGGGACCATTGAAATTGAGGGA
rJMFF050M22+ GAGTTCAGCGTGCTGTGACTGGAGTGGCAAATGGAAGCGGGGACCATTGAAATTGAGGGA
rJMFF027L13+ GAGTTCAGCGTGCTGTGACTGGAGTNGCAAATNGAAGCGGGGACCANCGAAATNGAGGGA
rJMFF009H15+ GAGTTCAGCGTGCTGTGACTGGAGTGGCAAATGGAAGCGGGGACCATTGAAATTGAGGGA
rJMFF042J15+ GAGTTCAGCGTGCTGTGACTGGAGTGGCAAATGGAAGCGGGGACCATTGAAATTGAGGGA
rJMFF003J15+ GAGTTCAGCGTGCTGTGACTGGAGTGGCAAANNGAAGCGGGGNCCANCGAAANNGAGGGA
JMFN034K11+ GAGTTCAGCGTGCTGTGACTGGAGTGGCAAATGGAAGCGGGGACCATTGAAATTGAGGGA
                      ____________________________________________________________
consensus GAGTTCAGCGTGCTGTGACTGGAGTGGCAAATGGAAGCGGGGACCATTGAAATTGAGGGA
 
. : . : . : . : . : . :
rJMFF023B04+ ATTGTTATCTCTGCTTCAAGATTTTCTATCTAGTAAAGAAGTGCAATATTCCAGTTGATC
rJMFF023J06+ ATTGTTATCTCTGCTTCAAGATTTTCTATCTAGTAAAGAAGTGCAATATTCCAGTTGATC
rJMFF034N12+ ATTGTTATCTCTGCTTCAAGATTTTCTATCTAGTAAAGAAGTGCAATATTCCAGTTGATC
rJMFF020D04+ ATTGTTATCTCTGCTTCAAGATTTTCTATCTAGTAAAGAAGTGCAATATTCCAGTTGATC
rJMFF023G24+ ATTGTTATCTCTGCTTCAAGATTTTCTATCTAGTAAAGAAGTGCAATATTCCAGTTGATC
rJMFF006A17+ ATTGTTATCTCTGCTTCAAGATTTTCTATCTAGTAAAGAAGTGCAATATTCCAGTTGATC
rJMFF050M22+ ATTGTTATCTCTGCTTCAAGATTTTCTATCTAGTAAAGAAGTGCAATATTCCAGTTGATC
rJMFF027L13+ ATNGTTATCTNTNCTTCAAGATNTTCTATNTAGTAAAGAAGTNCAATATTCCAG
rJMFF009H15+ ATTGTTATCTCTGCTTCAAGATTTTCTATCTAGTAAAGAAGTGCAATATTCCAGTTGATC
rJMFF042J15+ ATTGTTATCTCTGCTTCAAGATTTTCTATCTAGTAAAGAAGTGCAATATTCCAGTTGATC
rJMFF003J15+ ATNGTTATCTNTNCTTCAAGATNTTCTATNTAGTAAAGAAGTGCAATATTCCAGCNGATN
JMFN034K11+ ATTGTTATCTCTGCTTCAAGATTTTCTATCTAGTAAAGAAGTGCAATATTCCAGTTGATC
                      ____________________________________________________________
consensus ATTGTTATCTCTGCTTCAAGATTTTCTATCTAGTAAAGAAGTGCAATATTCCAGTTGATC
 
. : . : . : . : . : . :
rJMFF023B04+ TGCAGTTCATCTTCATCTTTAAGTAATTAAGAAGTTATCTGGTTATGTTTTATCCTGTTT
rJMFF023J06+ TGCAGTTCATCTTCATCTTTAAGTAATTAAGAAGTTATCTGGTTATGTTTTATCCTGTTT
rJMFF034N12+ TGCAGTTCATCTTCATCTTTAAGTAATTAAGAAGTTATCTGGTTATGTTTTATCCTGTTT
rJMFF020D04+ TGCAGTTCATCTTCATCTTTAAGTAATTAAGAAGTTATCTGGTTATGTTTTATCCTGTTT
rJMFF023G24+ TGCAGTTCATCTTCATCTTTAAGTAATTAAGAAGTTATCTGGTTATGTTTTATCCTGTTT
rJMFF006A17+ TGCAGTTCATCTTCATCTTTAAGTAATTAAGAAGTTATCTGGTTATGTTTTATCCTGTTT
rJMFF050M22+ TGCAGTTCATCTTCATCTTTAAGTAATTAAGAAGTTATCTGGTTATGTTTTATCCTGTTT
rJMFF009H15+ TGCAGTTCATCTTCATCTTTAAGTAATTAAGAAGTTATCTGGTTATGTTTTATCCTGTTT
rJMFF042J15+ TGCAGTTCATCTTCATCTTTAAGTAATTAAGAAGTTATCTGGTTATGTTTTATCCTGTTT
rJMFF003J15+ NNCAGNTCATCNTCATCNTTAAGTAATTAAGAAG
JMFN034K11+ TGCAGTTCATCTTCATCTTTAAGTAATTAAGAAGTTATCTGGTTATGTTTTATCCTGTTT
                      ____________________________________________________________
consensus TGCAGTTCATCTTCATCTTTAAGTAATTAAGAAGTTATCTGGTTATGTTTTATCCTGTTT
 
. : . : . : . : . : . :
rJMFF023B04+ TATTTTATGATGCCTAGACTCATATGGCCANTAGGCCAG
rJMFF023J06+ TATTTTATGATGCCTAGACTCATATGGCCAGTAGGCCAGAA
rJMFF034N12+ TATTTTATGATGCCTAGACTCATATGGCCAGTAGGCCAGAATGCAA
rJMFF020D04+ TATTTTATGATGCCTAGACTCATATGGCCAGTAGGCCAGAATGCAA
rJMFF023G24+ TATTTTATGATGCCTAGACTCATATGGCCAGTAGGCCAGAATGCAA
rJMFF006A17+ TATTTTATGATGCCTAGACTCATATGGCCAGTAGGCCAGAATGCAATGATGAAGTTT
rJMFF050M22+ TATTTTATGATGCCTAGACTCATATGGCCAGTAGGCCAGAATGCAATGATGAAGTTTCAT
rJMFF009H15+ TATTTTATGATGCCTAGACTCATATGGCCAGTAGGCCAGAATGCAATGATGAAGTTTCAT
rJMFF042J15+ TATTTTATGATGCCTAGACTCATATGGCCAGTAGGCCAGAATGCAATGATGAAGTTTTAT
JMFN034K11+ TATTTTATGATGCCTAGACTCATATGGCCAGTAGGCCAGAATGCAATGATGAAGTTTCAT
                      ____________________________________________________________
consensus TATTTTATGATGCCTAGACTCATATGGCCAGTAGGCCAGAATGCAATGATGAAGTTTCAT
 
. : . : . : . : . : . :
rJMFF050M22+ TTAGAG
rJMFF009H15+ TTAGAG
rJMFF042J15+ TTAGAGAA
JMFN034K11+ TTAGAGAAGAAAGATCTGATGATTXXXXXXXXXXXXXXXXXXXXCTCGAGACTAGTTCTC
                      ____________________________________________________________
consensus TTAGAGAAGAAAGATCTGATGATTNNNNNNNNNNNNNNNNNNNNCTCGAGACTAGTTCTC