Previous Contig 002635:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN034J19Sequence629002635 (3)gb:BT005452_16383927e-32Arabidopsis thaliana clone U50756 unknown protein (At5g39800) mRNA, complete cds
JMFN043J08Sequence620002635 (3)gb:BT005452_16383926e-32Arabidopsis thaliana clone U50756 unknown protein (At5g39800) mRNA, complete cds
JMFN046F17Sequence566002635 (3)gb:BT005452_16383925e-32Arabidopsis thaliana clone U50756 unknown protein (At5g39800) mRNA, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN043J08+ CAACCCGGACAAAACACGAAGCGGGGTTGGTGAGTGAAGAAACATC
JMFN034J19+ GAAGCGGGGTTGGTGAGTGAAGAAACATC
                      ____________________________________________________________
consensus CAACCCGGACAAAACACGAAGCGGGGTTGGTGAGTGAAGAAACATC
 
. : . : . : . : . : . :
JMFN043J08+ AAACATGTAGGGATCAAGTAATCTAATGTATTAGGGGAATGCATTCAGAAAATATGGCGA
JMFN046F17+ TATTAGGGGAATGCATTCAGAAAATATGGCGA
JMFN034J19+ AAACATGTAGGGATCAAGTAATCTAATGTATTAGGGGAATGCATTCAGAAAATATGGCGA
                      ____________________________________________________________
consensus AAACATGTAGGGATCAAGTAATCTAATGTATTAGGGGAATGCATTCAGAAAATATGGCGA
 
. : . : . : . : . : . :
JMFN043J08+ GAGTGTACGATGAAATCTTTCAGAAGAAAGAGCAAAATGAAGCGAAAGTATGAATTGTGT
JMFN046F17+ GAGTGTACGATGAAATCTTTCAGAAGAAAGAGCAAAATGAAGCGAAAGTATGAATTGTGT
JMFN034J19+ GAGTGTACGATGAAATCTTTCAGAAGAAAGAGCAAAATGAAGCGAAAGTATGAATTGTGT
                      ____________________________________________________________
consensus GAGTGTACGATGAAATCTTTCAGAAGAAAGAGCAAAATGAAGCGAAAGTATGAATTGTGT
 
. : . : . : . : . : . :
JMFN043J08+ ACTTCCTACAATCCTACTGAGATATTATTTAGCAGAATCGGCAGCCTCTGCTGTTTTGGC
JMFN046F17+ ACTTCCTACAATCCTACTGAGATATTATTTAGCAGAATCGGCAGCCTCTGCTGTTTTGGC
JMFN034J19+ ACTTCCTACAATCCTACTGAGATATTATTTAGCAGAATCGGCAGCCTCTGCTGTTTTGGC
                      ____________________________________________________________
consensus ACTTCCTACAATCCTACTGAGATATTATTTAGCAGAATCGGCAGCCTCTGCTGTTTTGGC
 
. : . : . : . : . : . :
JMFN043J08+ TTCTGTTGGGCACTGCGATACGTATGGCTTTAGCTTGAAACCGGTTAAATCTGGAACCAC
JMFN046F17+ TTCTGTTGGGCACTGCGATACGTATGGCTTTAGCTTGAAACCGGTTAAATCTGGAACCAC
JMFN034J19+ TTCTGTTGGGCACTGCGATACGTATGGCTTTAGCTTGAAACCGGTTAAATCTGGAACCAC
                      ____________________________________________________________
consensus TTCTGTTGGGCACTGCGATACGTATGGCTTTAGCTTGAAACCGGTTAAATCTGGAACCAC
 
. : . : . : . : . : . :
JMFN043J08+ ATAATTAGGAAGCTTTTCTGGAACCACGACATAACCGCCTTTGCGAGTGTGGAAGCCAGT
JMFN046F17+ ATAATTAGGAAGCTTTTCTGGAACCACGACATAACCGCCTTTGCGAGTGTGGAAGCCAGT
JMFN034J19+ ATAATTAGGAAGCTTTTCTGGAACCACGACATAACCGCCTTTGCGAGTGTGGAAGCCAGT
                      ____________________________________________________________
consensus ATAATTAGGAAGCTTTTCTGGAACCACGACATAACCGCCTTTGCGAGTGTGGAAGCCAGT
 
. : . : . : . : . : . :
JMFN043J08+ GGGTATGCAATTCTTGCCCTTGTAGAAACCCCTCGGACCACGTTTGGAAGTGAGAATTTC
JMFN046F17+ GGGTATGCAATTCTTGCCCTTGTAGAAACCCCTCGGACCACGTTTGGAAGTGAGAATTTC
JMFN034J19+ GGGTATGCAATTCTTGCCCTTGTAGAAACCCCTCGGACCACGTTTGGAAGTGAGAATTTC
                      ____________________________________________________________
consensus GGGTATGCAATTCTTGCCCTTGTAGAAACCCCTCGGACCACGTTTGGAAGTGAGAATTTC
 
. : . : . : . : . : . :
JMFN043J08+ GAGAGAAGATGTTCGCTTTCTTCTGAATGACCTTGCAAGTCCAAGCAATAGCCCCAGCGC
JMFN046F17+ GAGAGAAGATGTTCGCTTTCTTCTGAATGACCTTGCAAGTCCAAGCAATAGCCCCAGCGC
JMFN034J19+ GAGAGAAGATGTTCGCTTTCTTCTGAATGACCTTGCAAGTCCAAGCAATAGCCCCAGCGC
                      ____________________________________________________________
consensus GAGAGAAGATGTTCGCTTTCTTCTGAATGACCTTGCAAGTCCAAGCAATAGCCCCAGCGC
 
. : . : . : . : . : . :
JMFN043J08+ CATTTTCTTCTTCTTGTTTCACAAAGAACCAGCGTAGAAATCTTCAAAGTTCAAACAATG
JMFN046F17+ CATTTTCTTCTTCTTGTTTCACAAAGAACCAGCGTAGAAATCTTCAAAGTTCAAACAATG
JMFN034J19+ CATTTTCTTCTTCTTGTTTCACAAAGAACCAGCGTAGAAATCTTCAAAGTTCAAACAATG
                      ____________________________________________________________
consensus CATTTTCTTCTTCTTGTTTCACAAAGAACCAGCGTAGAAATCTTCAAAGTTCAAACAATG
 
. : . : . : . : . : . :
JMFN043J08+ GCGAGAACGGAAGCAGGGCAGGTGATCGGCGGGCTCGGCGCTGTCGCAGGGGAGGGGAGG
JMFN046F17+ GCGAGAACGGAAGCAGGGCAGGTGATCGGCGGGCTCGGCGCTGTCGCAGGGGAGGGGAGG
JMFN034J19+ GCGAGAACGGAAGCAGGGCAGGTGATCGGCGGGCTCGGCGCTGTCGCAGGGGAGGGGAGG
                      ____________________________________________________________
consensus GCGAGAACGGAAGCAGGGCAGGTGATCGGCGGGCTCGGCGCTGTCGCAGGGGAGGGGAGG
 
. : . : . : . : . : . :
JMFN043J08+ AGCAGTGGATTGTGGAGGCGCTGTGGTGATTTTG
JMFN046F17+ AGCAGTGGATTGTGGAGGCGCTGTGGTGATTTTGTCTAGGGAGCGCTGGTTCGG
JMFN034J19+ AGCAGTGGATTGTGGAGGCGCTGTGGTGATTTTGTCTAGGGAGCGCTGGTTCGGCTGGAG
                      ____________________________________________________________
consensus AGCAGTGGATTGTGGAGGCGCTGTGGTGATTTTGTCTAGGGAGCGCTGGTTCGGCTGGAG