Previous Contig 002632:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN034J04Sequence604002632 (2)
JMSF006O24Sequence306018502409002632 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN034J04- TCTAG
                      ____________________________________________________________
consensus TCTAG
 
. : . : . : . : . : . :
JMFN034J04- CCCTTTGGTGGAGGGGCAGAGTTGGGAGATCGGCAATATTGCATTGTGGGGAATCGAGGG
                      ____________________________________________________________
consensus CCCTTTGGTGGAGGGGCAGAGTTGGGAGATCGGCAATATTGCATTGTGGGGAATCGAGGG
 
. : . : . : . : . : . :
JMFN034J04- TAGCGGTCCGAATATACCTAAAGTCTTAGGTGTTTAAAACTTTTTGTTCCATTTTTAGCC
                      ____________________________________________________________
consensus TAGCGGTCCGAATATACCTAAAGTCTTAGGTGTTTAAAACTTTTTGTTCCATTTTTAGCC
 
. : . : . : . : . : . :
rJMSF006O24+ ACTTTTAATTTTTTTTTCGGTGACGGGGAAACCCGTAGTCACTACTTCAGGAAGT
JMFN034J04- TTGGCACTTTTAATTTTTTTTTCGGTGACGGGGAAACCCGTAGTCACTACTTCAGGAAGT
                      ____________________________________________________________
consensus TTGGCACTTTTAATTTTTTTTTCGGTGACGGGGAAACCCGTAGTCACTACTTCAGGAAGT
 
. : . : . : . : . : . :
rJMSF006O24+ GTACTGGGTAAATTCAGCTTTGTAACCTTAGCGGACAAGAATCACAAGGAGATAAATCAG
JMFN034J04- GTACTGGGTAAATTCAGCTTTGTAACCTTAGCGGACAAGAATCACAAGGAGATAAATCAG
                      ____________________________________________________________
consensus GTACTGGGTAAATTCAGCTTTGTAACCTTAGCGGACAAGAATCACAAGGAGATAAATCAG
 
. : . : . : . : . : . :
rJMSF006O24+ TCTAAATTGTTCATAGCTGATCAGCTCAAACAAATATGGCTGAGATTCGAACACGTGACC
JMFN034J04- TCTAAATTGTTCATAGCTGATCAGCTCAAACAAATATGGCTGAGATTCGAACACGTGACC
                      ____________________________________________________________
consensus TCTAAATTGTTCATAGCTGATCAGCTCAAACAAATATGGCTGAGATTCGAACACGTGACC
 
. : . : . : . : . : . :
rJMSF006O24+ TTGTCGTTACAAGTTTGTATCCTTAGTTATCTTGGCTGGGTTACCCGGTACTTTAATTTG
JMFN034J04- TTGTCGTTACAAGTTTGTATCCTTAGTTATCTTGGCTGGGTTACCCGGTACTTTAATTTG
                      ____________________________________________________________
consensus TTGTCGTTACAAGTTTGTATCCTTAGTTATCTTGGCTGGGTTACCCGGTACTTTAATTTG
 
. : . : . : . : . : . :
rJMSF006O24+ TTTTAATTTCTGTTTTCTGCTACTAATCTACATATAGCTTGAGATGGGATGTAAGAGATG
JMFN034J04- TTTTAATTTCTGTTTTCTGCTACTAATCTACATATAGCTTGAGATGGGATGTAAGAGATG
                      ____________________________________________________________
consensus TTTTAATTTCTGTTTTCTGCTACTAATCTACATATAGCTTGAGATGGGATGTAAGAGATG
 
. : . : . : . : . : . :
rJMSF006O24+ CATACGAGGCAGCTAAGCTTTGTTTGTTTGGGTGTAGAAGTCTAGTTGGGGTGGTTTCGC
JMFN034J04- CATACGAGGCAGCTAAGCTTTGTTTGTTTGGGTGTAGAAGTCTAGTTGGGGTGGTTTCGC
                      ____________________________________________________________
consensus CATACGAGGCAGCTAAGCTTTGTTTGTTTGGGTGTAGAAGTCTAGTTGGGGTGGTTTCGC
 
. : . : . : . : . : . :
rJMSF006O24+ AATTTATGCTAAAATTAGGGGTCTGATTCTGTTGGAAGTGTTGCTATTTAATTT
JMFN034J04- AATTTATGCTAAAATTAGGGGTCTGA-TCTGTTGGAAGTGTTGCTATTTAATTTTATGCT
                      ____________________________________________________________
consensus AATTTATGCTAAAATTAGGGGTCTGATTCTGTTGGAAGTGTTGCTATTTAATTTTATGCT
 
. : . : . : . : . : . :
JMFN034J04- GCTGGGCATGCATCACTTACACCCATATTATAATGTAAGTTTCTTTCTCATGTGCACTAT
                      ____________________________________________________________
consensus GCTGGGCATGCATCACTTACACCCATATTATAATGTAAGTTTCTTTCTCATGTGCACTAT