Previous Contig 002631:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN006A24Sequence616002631 (5)gb:AC105729_17380053e-51Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1607A12, complete se
JMFN034I23Sequence613002631 (5)pir|T47615|T476154e-55histone H2A.F/Z - Arabidopsis thaliana>gb:ATH2AV_1552417 Arabidopsis thaliana mR
JMSF011L18Sequence376002631 (5)pir|T47615|T476153e-25histone H2A.F/Z - Arabidopsis thaliana>gb:ATH2AV_1552417 Arabidopsis thaliana mR701002631 (5)gb:AC105729_17380054e-51Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1607A12, complete se
JMSF044C01Sequence505002502 (7)pir|T50532|T505327e-37ribosomal protein S27 - Arabidopsis thaliana>gb:ATT27I15_1555545 Arabidopsis tha709002631 (5)gb:AC105729_17380053e-50Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1607A12, complete se

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF044C01+ CATCA
                      ____________________________________________________________
consensus CATCA
 
. : . : . : . : . : . :
rJMSF011L18+ TCTCAGATAGTCAGACAATTACCTAGTTACCGCTTTCTCATTCCTCGGCTCCTCG
JMSF011L18- TCTCAGATAGTCAGACAATTACCTAGTTACCGCTTTCTCATTCCTCGGCTCCTCG
rJMSF044C01+ CGAGGTCTCAGATAGTCAGACAATTACCTAGTTACCGCTTTCTCATTCCTCGGCTCCTCG
JMFN006A24- TTTCTCATTCCTCGGCTCCTCG
                      ____________________________________________________________
consensus CGAGGTCTCAGATAGTCAGACAATTACCTAGTTACCGCTTTCTCATTCCTCGGCTCCTCG
 
. : . : . : . : . : . :
rJMSF011L18+ CTCTCCGCTTCTATTCGTTGTCTGCTTCCTATACTATAAGAATGGCTGGAAAGGGTGGAA
JMSF011L18- CTCTCCGCTTCTATTCGTTGTCTGCTTCCTATACTATAAGAATGGCTGGAAAGGGTGGAA
rJMSF044C01+ CTCTCCGCTTCTATTCGTTGTCTGCTTCCTATACTATAAGAATGGCTGGAAAGGGTGGAA
JMFN006A24- CTCTCCGCTTCTATTCGTTGTCTGCTTCCTATACTATAAGAATGGCTGGAAAGGGTGGAA
                      ____________________________________________________________
consensus CTCTCCGCTTCTATTCGTTGTCTGCTTCCTATACTATAAGAATGGCTGGAAAGGGTGGAA
 
. : . : . : . : . : . :
rJMSF011L18+ AGGGGCTTTTGGCGGGAAAGACCACAGCTGCGGCGGCGGCGGCGGCGAACAAGGACAAGG
JMSF011L18- AGGGGCTTTTGGCGGGAAAGACCACAGCTGCGGCGGCGGCGGCGGCGAACAAGGACAAGG
rJMSF044C01+ AGGGGCTTTTGGCGGGAAAGACCACAGCTGCGGCGGCGGCGGCGGCGAACAAGGACAAGG
JMFN006A24- AGGGGCTTTTGGCGGGAAAGACCACAGCTGCGGCGGCGGCGGCGGCGAACAAGGACAAGG
JMFN034I23+ GAACAAGGACAAGG
                      ____________________________________________________________
consensus AGGGGCTTTTGGCGGGAAAGACCACAGCTGCGGCGGCGGCGGCGGCGAACAAGGACAAGG
 
. : . : . : . : . : . :
rJMSF011L18+ ACAAGAAAAGGCCAGTTTCTCGATCTTCTCGCGCAGGTCTCCAGTTTCCAGTTGGGCGAA
JMSF011L18- ACAAGAAAAGGCCAGTTTCTCGATCTTCTCGCGCAGGTCTCCAGTTTCCAGTTGGGCGAA
rJMSF044C01+ ACAAGAAAAGGCCAGTTTCTCGATCTTCTCGCGCAGGTCTCCAGTTTCCAGTTGGGCGAA
JMFN006A24- ACAAGAAAAGGCCAGTTTCTCGATCTTCTCGCGCAGGTCTCCAGTTTCCAGTTGGGCGAA
JMFN034I23+ ACAAGAAAAGGCCAGTTTCTCGATCTTCTCGCGCAGGTCTCCAGTTTCCAGTTGGGCGAA
                      ____________________________________________________________
consensus ACAAGAAAAGGCCAGTTTCTCGATCTTCTCGCGCAGGTCTCCAGTTTCCAGTTGGGCGAA
 
. : . : . : . : . : . :
rJMSF011L18+ TTCACCGTCAGCTGAAGACCCGAACCTCAGCTCATGGCAGGGTTGGAGCAACAGCCGCGG
JMSF011L18- TTCACCGTCAGCTGAAGACCCGAACCTCAGCTCATGGCAGGGTTGGAGCAACAGCCGCGG
rJMSF044C01+ TTCACCGTCAGCTGAAGACCCGAACCTCAGCTCATGGCAGGGTTGGAGCAACAGCCGCGG
JMFN006A24- TTCACCGTCAGCTGAAGACCCGAACCTCAGCTCATGGCAGGGTTGGAGCAACAGCCGCGG
JMFN034I23+ TTCACCGTCAGCTGAAGACCCGAACCTCAGCTCATGGCAGGGTTGGAGCAACAGCCGCGG
                      ____________________________________________________________
consensus TTCACCGTCAGCTGAAGACCCGAACCTCAGCTCATGGCAGGGTTGGAGCAACAGCCGCGG
 
. : . : . : . : . : . :
rJMSF011L18+ TTTACACAGCGGCAATCCTCGAGTATCTAACAGCAGAGGTGCTCGAATTGGCTGGGAACG
JMSF011L18- TTTACACAGCGGCAATCCTCGAGTATCTAACAGCAGAGGTGCTCGAATTGGCTGGGAACG
rJMSF044C01+ TTTACACAGCGGCAATCCTCGAGTATCTAACAGCAGAGGTGCTCGAATTGGCTGGGAACG
JMFN006A24- TTTACACAGCGGCAATCCTCGAGTATCTAACAGCAGAGGTGCTCGAATTGGCTGGGAACG
JMFN034I23+ TTTACACAGCGGCAATCCTCGAGTATCTAACAGCAGAGGTGCTCGAATTGGCTGGGAACG
                      ____________________________________________________________
consensus TTTACACAGCGGCAATCCTCGAGTATCTAACAGCAGAGGTGCTCGAATTGGCTGGGAACG
 
. : . : . : . : . : . :
rJMSF011L18+ CCAGCAAGGATCTGAAAGTGAAGAGGATCACACCGAGGCACTTGCAGCTGGCCATTCGTG
JMSF011L18- CCNGCAAGGATCTGAAA
rJMSF044C01+ CCAGCAAGGATCTGAAAGTGAAGAGGATCACACCGAGGCACTTGCAGCTGGCCATTCGTG
JMFN006A24- CCAGCAAGGATCTGAAAGTGAAGAGGATCACACCGAGGCACTTGCAGCTGGCCATTCGTG
JMFN034I23+ CCAGCAAGGATCTGAAAGTGAAGAGGATCACACCGAGGCACTTGCAGCTGGCCATTCGTG
                      ____________________________________________________________
consensus CCAGCAAGGATCTGAAAGTGAAGAGGATCACACCGAGGCACTTGCAGCTGGCCATTCGTG
 
. : . : . : . : . : . :
rJMSF011L18+ GAGACGAGGAGCTTGACACCCTCATCAAGGGAACCATTGCTGGTGGTGGAGTCATCCCCC
rJMSF044C01+ GAGACGAGGAGCTTGACACCCTCATCAAGGGAACCATTGCTGGTCGTGGAGTCATCCCCC
JMFN006A24- GAGACGAGGAGCTTGACACCCTCATCAAGGGAACCATTGCTGGTGGTGGAGTCATCCCCC
JMFN034I23+ GAGACGAGGAGCTTGACACCCTCATCAAGGGAACCATTGCTGGTGGTGGAGTCATCCCCC
                      ____________________________________________________________
consensus GAGACGAGGAGCTTGACACCCTCATCAAGGGAACCATTGCTGGTGGTGGAGTCATCCCCC
 
. : . : . : . : . : . :
rJMSF011L18+ ACATTCACAAGTCCCTCATCAACAAAAC
rJMSF044C01+ ACATTCACAAGTCCCTCATCAACAAAAC
JMFN006A24- ACATTCACAAGTCCCTCATCAACAAAACAAACCCCAAGGAATGAATGAATGAAAACCATA
JMFN034I23+ ACATTCACAAGTCCCTCATCAACAAAACAAACCCCAAGGAATGAATGAATGAAAACCATA
                      ____________________________________________________________
consensus ACATTCACAAGTCCCTCATCAACAAAACAAACCCCAAGGAATGAATGAATGAAAACCATA
 
. : . : . : . : . : . :
JMFN006A24- TGTTTAACTTTAGAAAAGGCTTCTGAGTAATTAAGACTCTTGTTGTTCTATCTTTTGCTT
JMFN034I23+ TCTTTAACTTTAGAAAAGGCTTCTGAGTAATTAAGACTCTTGTTGTTCTATC-TTTGCTT
                      ____________________________________________________________
consensus TGTTTAACTTTAGAAAAGGCTTCTGAGTAATTAAGACTCTTGTTGTTCTATCTTTTGCTT
 
. : . : . : . : . : . :
JMFN006A24- GTAATAAGCTGTTCTGTTAGGATGTTGTTTTGTTGGAATGGTACTTGTGCTGGT
JMFN034I23+ GTAATAAGCTGTTCTGTTAGGATGTTGTTTTGTTGGAATGGTACTTGTGCTGGTAAAATA
                      ____________________________________________________________
consensus GTAATAAGCTGTTCTGTTAGGATGTTGTTTTGTTGGAATGGTACTTGTGCTGGTAAAATA
 
. : . : . : . : . : . :
JMFN034I23+ CTTTTGGCTGGATAAGTTTGATTTATCTGTAATTTGTGTAGTCTTGGATGTATTAACAAT
                      ____________________________________________________________
consensus CTTTTGGCTGGATAAGTTTGATTTATCTGTAATTTGTGTAGTCTTGGATGTATTAACAAT
 
. : . : . : . : . : . :
JMFN034I23+ TGTAACGGAAGCCCTGTTCAACAGTXXXXXXXXXXXXXXXXXXXCTCGAGACTAGTTCTC
                      ____________________________________________________________
consensus TGTAACGGAAGCCCTGTTCAACAGTNNNNNNNNNNNNNNNNNNNCTCGAGACTAGTTCTC