Previous Contig 002628:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN034H16Sequence618002628 (3)gb:OSJN00274_16977802e-65Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0061C13, complete seque
JMSF048E06Sequence656002628 (3)gb:CQ831410_14537158e-84Sequence 17 from Patent WO2004057003.774002628 (3)gb:AC006202_15336052e-94Arabidopsis thaliana chromosome 2 clone T3B23 map mi54, complete sequence.>gb:AC

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF048E06- GTGTTTGTTACAAGAAAGAAATTTCCTCTCAATGAAAGTTGGC
                      ____________________________________________________________
consensus GTGTTTGTTACAAGAAAGAAATTTCCTCTCAATGAAAGTTGGC
 
. : . : . : . : . : . :
rJMSF048E06- TGCCTAGGCCTAGCTTGAATTTGAGGCTTTTCCTAAAATAAGCCAATAATAGATTACCAT
                      ____________________________________________________________
consensus TGCCTAGGCCTAGCTTGAATTTGAGGCTTTTCCTAAAATAAGCCAATAATAGATTACCAT
 
. : . : . : . : . : . :
rJMSF048E06- TCTCTTTAGATACTTCAATTCCCTCTTTTTTGGAGTAAACAACACTATTTTTATGACATT
                      ____________________________________________________________
consensus TCTCTTTAGATACTTCAATTCCCTCTTTTTTGGAGTAAACAACACTATTTTTATGACATT
 
. : . : . : . : . : . :
rJMSF048E06- AATAATTAATTAGTAATTTAATTGATCCTTTTCCCACTTCTGCTTTGATGCAACTCGTTC
                      ____________________________________________________________
consensus AATAATTAATTAGTAATTTAATTGATCCTTTTCCCACTTCTGCTTTGATGCAACTCGTTC
 
. : . : . : . : . : . :
rJMSF048E06- ATGGCAGGGATTGTATTCCTCCAATTCATTCATTAGCTCTTTTGCATTAGGGGCTGAGAC
JMSF048E06+ GGCTGAGAC
                      ____________________________________________________________
consensus ATGGCAGGGATTGTATTCCTCCAATTCATTCATTAGCTCTTTTGCATTAGGGGCTGAGAC
 
. : . : . : . : . : . :
rJMSF048E06- GAAAATTTGGCGCGCATTTGGGCTGATGAATCCTTCTTCTACAGCTTTGTCAATAAATGT
JMSF048E06+ GAAAATTTGGCGCGCATTTGGGCTGATGAATCCTTCTTCTACAGCTTTGTCAATAAATGT
                      ____________________________________________________________
consensus GAAAATTTGGCGCGCATTTGGGCTGATGAATCCTTCTTCTACAGCTTTGTCAATAAATGT
 
. : . : . : . : . : . :
rJMSF048E06- GAGCAGAGAATTATAGTAACCTTCTACATTCAGTAACCCCACCGGTTTATCATGGATGCC
JMSF048E06+ GAGCAGAGAATTATAGTAACCTTCTACATTCAGTAACCCCACCGGTTTATCATGGATGCC
JMFN034H16+ CGGTTTATCATGGATGCC
                      ____________________________________________________________
consensus GAGCAGAGAATTATAGTAACCTTCTACATTCAGTAACCCCACCGGTTTATCATGGATGCC
 
. : . : . : . : . : . :
rJMSF048E06- AAGTTGAGCCCAAGCTATGACTTCAAGAAGCTCTTCTAGAGTTCCATACCCACCAGGTAA
JMSF048E06+ AAGTTGAGCCCAAGCTATGACTTCAAGAAGCTCTTCTAGAGTTCCATACCCACCAGGTAA
JMFN034H16+ AAGTTGAGCCCAAGCTATGACTTCAAGAAGCTCTTCTAGAGTTCCATACCCACCAGGTAA
                      ____________________________________________________________
consensus AAGTTGAGCCCAAGCTATGACTTCAAGAAGCTCTTCTAGAGTTCCATACCCACCAGGTAA
 
. : . : . : . : . : . :
rJMSF048E06- AGCAATAAAGGCATCAGAATGCTTAGCCATCTCAGCTTTCCTCTGGTGCATATCAGCTAC
JMSF048E06+ AGCAATAAAGGCATCAGAATGCTTAGCCATCTCAGCTTTCCTCTGGTGCATATCAGCTAC
JMFN034H16+ AGCAATAAAGGCATCAGAATGCTTAGCCATCTCAGCTTTCCTCTGGTGCATATCAGCTAC
                      ____________________________________________________________
consensus AGCAATAAAGGCATCAGAATGCTTAGCCATCTCAGCTTTCCTCTGGTGCATATCAGCTAC
 
. : . : . : . : . : . :
rJMSF048E06- AGCCTTTACTTCTCCCACTGTTTCCCCAGTTATCTCTCTTGGCAGAAGAGTCTTGGGAAT
JMSF048E06+ AGCCTTTACTTCTCCCACTGTTTCCCCAGTTATCTCTCTTGGCAGAAGAGTCTTGGGAAT
JMFN034H16+ AGCCTTTACTTCTCCCACTGTTTCCCCAGTTATCTCTCTTGGCAGAAGAGTCTTGGGAAT
                      ____________________________________________________________
consensus AGCCTTTACTTCTCCCACTGTTTCCCCAGTTATCTCTCTTGGCAGAAGAGTCTTGGGAAT
 
. : . : . : . : . : . :
rJMSF048E06- AACTCCAAGGACATGACGGCCACCATTGTAAACAGCTTGAGAGACCAGTCCCATCAACCC
JMSF048E06+ AACTCCAAGGACATGACGGCCACCATTGTAAACAGCTTGAGAGACCAGTCCCATCAACCC
JMFN034H16+ AACTCCAAGGACATGACGGCCACCATTGTAAACAGCTTGAGAGACCAGTCCCATCAACCC
                      ____________________________________________________________
consensus AACTCCAAGGACATGACGGCCACCATTGTAAACAGCTTGAGAGACCAGTCCCATCAACCC
 
. : . : . : . : . : . :
rJMSF048E06- AATGCTTCCTCCTCCATACACTAAGTCTATATTCCTTGATACCAATTCTTTGCCAAGTTC
JMSF048E06+ AATGCTTCCTCCTCCATACACTAAGTCTATATTCCTTGATACCAATTCTTTGCCAAGTTC
JMFN034H16+ AATGCTTCCTCCTCCATACACTAAGTCTATATTCCTTGATACCAATTCTTTGCCAAGTTC
                      ____________________________________________________________
consensus AATGCTTCCTCCTCCATACACTAAGTCTATATTCCTTGATACCAATTCTTTGCCAAGTTC
 
. : . : . : . : . : . :
rJMSF048E06- AATGGCTGCTTCTTTATAGGAATTCTTCTTGCCAGGGCTACTGCCACAGAACACACAAAT
JMSF048E06+ AATGGCTGCTTCTTTATAGGAATTCTTCTTGCCAGGGCTACTGCCACAGAACACACAAAT
JMFN034H16+ AATGGCTGCTTCTTTATAGGAATTCTTCTTGCCAGGGCTACTGCCACAGAACACACAAAT
                      ____________________________________________________________
consensus AATGGCTGCTTCTTTATAGGAATTCTTCTTGCCAGGGCTACTGCCACAGAACACACAAAT
 
. : . : . : . : . : . :
rJMSF048E06- TCTTTTGAATT
JMSF048E06+ TCTTTTGAATTTGGACTGTTGTAATGCTTCTTTCTCCTTTCCCACCTCCATACTTCTTCT
JMFN034H16+ TCTTTTGAATTTGGACTGTTGTAATGCTTCTTTCTCCTTTCCCACCTCCATACTTCTTCT
                      ____________________________________________________________
consensus TCTTTTGAATTTGGACTGTTGTAATGCTTCTTTCTCCTTTCCCACCTCCATACTTCTTCT
 
. : . : . : . : . : . :
JMSF048E06+ TCTCTCTCTCTCTTCCTACTTTTATTTTCTCTGAATAATGTGTGGGAGATAGGCTTTTTG
JMFN034H16+ TCTCTCTCTCTCTTCCTACTTTTATTTTCTCTGAATAATGTGTGGGAGATAGGCTTTTTG
                      ____________________________________________________________
consensus TCTCTCTCTCTCTTCCTACTTTTATTTTCTCTGAATAATGTGTGGGAGATAGGCTTTTTG
 
. : . : . : . : . : . :
JMSF048E06+ GTGAGAGTTTGTGTTGTGCTAAATCTTGTAGACTTATAGTGCCTTT
JMFN034H16+ GTGAGAGTTTGTGTTGTGCTAAATCTTGTAGACTTATAGTGCCTTTTGTACTAAGCTCTC
                      ____________________________________________________________
consensus GTGAGAGTTTGTGTTGTGCTAAATCTTGTAGACTTATAGTGCCTTTTGTACTAAGCTCTC
 
. : . : . : . : . : . :
JMFN034H16+ TCTCTCTCTCTATCTGCTGTTGTCTTCCCCACAGTTGGGGGCAGGAGGCCACTTCACAAA
                      ____________________________________________________________
consensus TCTCTCTCTCTATCTGCTGTTGTCTTCCCCACAGTTGGGGGCAGGAGGCCACTTCACAAA