Previous Contig 002626:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN013A16Sequence488002626 (3)
JMFN013I17Sequence515002626 (3)
JMFN034E17Sequence490002626 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN013I17+ AATGTGAAACCTAATTCATTACAAAAAATGTGAAAAAACAG
JMFN013A16+ GAAAAAACAG
JMFN034E17+ GAAAAAACAG
                      ____________________________________________________________
consensus AATGTGAAACCTAATTCATTACAAAAAATGTGAAAAAACAG
 
. : . : . : . : . : . :
JMFN013I17+ ATCATTGTATTGGCAACAAAAGGCTCATTCCCAATGGAAAACACTTTGTTTGATAACTTC
JMFN013A16+ ATCATTGTATTGGCAACAAAAGGCTCATTCCCAATGGAAAACACTTTGTTTGATAACTTC
JMFN034E17+ ATCATTGTATTGGCAACAAAAGGCTCATTCCCAATGGAAAACACTTTGTTTGATAACTTC
                      ____________________________________________________________
consensus ATCATTGTATTGGCAACAAAAGGCTCATTCCCAATGGAAAACACTTTGTTTGATAACTTC
 
. : . : . : . : . : . :
JMFN013I17+ AGGAATATAAATTTAGAGCGCTGGAAAAAGAAAAATAAAGGCAGATTTTAATCTGCATCC
JMFN013A16+ AGGAATATAAATTTAGAGCGCTGGAAAAAGAAAAATAAAGGCAGATTTTAATCTGCATCC
JMFN034E17+ AGGAATATAAATTTAGAGCGCTGGAAAAAGAAAAATAAAGGCAGATTTTAATCTGCATCC
                      ____________________________________________________________
consensus AGGAATATAAATTTAGAGCGCTGGAAAAAGAAAAATAAAGGCAGATTTTAATCTGCATCC
 
. : . : . : . : . : . :
JMFN013I17+ TCAGCCTTGGGTTGCTCGAGGGAAGCCTGAGCATTGGAGAGGGCCTCCAATACTATTGCA
JMFN013A16+ TCAGCCTTGGGTTGCTCGAGGGAAGCCTGAGCATTGGAGAGGGCCTCCAATACTATTGCA
JMFN034E17+ TCAGCCTTGGGTTGCTCGAGGGAAGCCTGAGCATTGGAGAGGGCCTCCAATACTATTGCA
                      ____________________________________________________________
consensus TCAGCCTTGGGTTGCTCGAGGGAAGCCTGAGCATTGGAGAGGGCCTCCAATACTATTGCA
 
. : . : . : . : . : . :
JMFN013I17+ GCGTGGTACTGAATATTACCGCACATGAGCTGGGATTCGGGTTCAGATTGGGAGTCCGTC
JMFN013A16+ GCGTGGTACTGAATATTACCGCACATGAGCTGGGATTCGGGTTCAGATTGGGAGTCCGTC
JMFN034E17+ GCGTGGTACTGAATATTACCGCACATGAGCTGGGATTCGGGTTCAGATTGGGAGTCCGTC
                      ____________________________________________________________
consensus GCGTGGTACTGAATATTACCGCACATGAGCTGGGATTCGGGTTCAGATTGGGAGTCCGTC
 
. : . : . : . : . : . :
JMFN013I17+ TCTATGTTCATCTTCTCCAGCTCCTGACTGATATGCTGGAGGGAGTCTTGAGCTTGTGCA
JMFN013A16+ TCTATGTTCATCTTCTCCAGCTCCTGACTGATATGCTGGAGGGAGTCTTGAGCTTGTGCA
JMFN034E17+ TCTATGTTCATCTTCTCCAGCTCCTGACTGATATGCTGGAGGGAGTCTTGAGCTTGTGCA
                      ____________________________________________________________
consensus TCTATGTTCATCTTCTCCAGCTCCTGACTGATATGCTGGAGGGAGTCTTGAGCTTGTGCA
 
. : . : . : . : . : . :
JMFN013I17+ ATGAAATCCATGCTCTTACCTACTGCTTTATGTAACTTCTCCTTTGAGGCTAAAAGATTA
JMFN013A16+ ATGAAATCCATGCTCTTACCTACTGCTTTATGTAACTTCTCCTTTGAGGCTAAAAGATTA
JMFN034E17+ ATGAAATCCATGCTCTTACCTACTGCTTTATGTAACTTCTCCTTTGAGGCTAAAAGATTA
                      ____________________________________________________________
consensus ATGAAATCCATGCTCTTACCTACTGCTTTATGTAACTTCTCCTTTGAGGCTAAAAGATTA
 
. : . : . : . : . : . :
JMFN013I17+ GTGATATGCGCTTCTTTTAAATTCATGATAGTAATCCAACCCTGCATCATCAGTTCCCTT
JMFN013A16+ GTGATATGCGCTTCTTTTAAATTCATGATAGTAATCCAACCCTGCATCATCAGTTCCCTT
JMFN034E17+ GTGATATGCGCTTCTTTTAAATTCATGATAGTAATCCAACCCTGCATCATCAGTTCCCTT
                      ____________________________________________________________
consensus GTGATATGCGCTTCTTTTAAATTCATGATAGTAATCCAACCCTGCATCATCAGTTCCCTT
 
. : . : . : . : . : . :
JMFN013I17+ GTCTGCATACTTCGAGACGAGGGCGGAGAGCGAGCTGTAGAAGGGGATGGCGTC
JMFN013A16+ GTCTGCATACTTCGAGACGAGGGCGGAGAGCGAGCTGTAGAAGGGGATGGCGTC
JMFN034E17+ GTCTGCATACTTCGAGACGAGGGCGGAGAGCGAGCTGTAGAAGGGGATGGCGTCATGGCG
                      ____________________________________________________________
consensus GTCTGCATACTTCGAGACGAGGGCGGAGAGCGAGCTGTAGAAGGGGATGGCGTCATGGCG