Previous Contig 002622:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN034D22Sequence571002622 (2)gb:AX647827_14725410.041Sequence 2019 from Patent EP1270724.
JMFN034D24Sequence398002622 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN034D22+ ATGAAAGATGATAATTATATAATATTGGANAA
                      ____________________________________________________________
consensus ATGAAAGATGATAATTATATAATATTGGANAA
 
. : . : . : . : . : . :
JMFN034D22+ AAGATAAACGGATTACCCGGAATTGTTATTCGGGTCTCTCAATATATACATGAAGTTTAA
                      ____________________________________________________________
consensus AAGATAAACGGATTACCCGGAATTGTTATTCGGGTCTCTCAATATATACATGAAGTTTAA
 
. : . : . : . : . : . :
JMFN034D24+ CCAAGCTAGAG
JMFN034D22+ CAGGTGCGTTCTGGGCAGGCCGGGTTTGCATTAATAAGAGAACCCAACACCAAGCTAAAG
                      ____________________________________________________________
consensus CAGGTGCGTTCTGGGCAGGCCGGGTTTGCATTAATAAGAGAACCCAACACCAAGCTAGAG
 
. : . : . : . : . : . :
JMFN034D24+ GGGAGATGAGAATTGGTCGAGGACGAGAGGCATTATGCAGGCATACATGCAGACATATAA
JMFN034D22+ GGGAAGTGAAAATTGATCGAAGACGAAATGCATTATGCATACATACATACATACATATAA
                      ____________________________________________________________
consensus GGGAGGTGAGAATTGGTCGAGGACGAGATGCATTATGCATGCATACATGCATACATATAA
 
. : . : . : . : . : . :
JMFN034D24+ GTTGTGGTGTTCTGGAGGGGATAGGATGATATATCCGAGGTAATTTAGCAGATGACGCAT
JMFN034D22+ GTTCTGGTCTTCTAGATGGGATACGATGATATATCCGAGGTAATTTAGCAGATGACGCAT
                      ____________________________________________________________
consensus GTTGTGGTGTTCTGGATGGGATAGGATGATATATCCGAGGTAATTTAGCAGATGACGCAT
 
. : . : . : . : . : . :
JMFN034D24+ GAAGTAGGACTGTCTTCCATGCTGTGGTGAACATAGTATGAACTGTGGGGTGTGGTTGGT
JMFN034D22+ GAATTAGGATTCTCTTCCATGCTGTGTTGAACATAGTATGAACTCTGGGGTGGTGGTGGT
                      ____________________________________________________________
consensus GAATTAGGATTGTCTTCCATGCTGTGTTGAACATAGTATGAACTGTGGGGTGTTGTTGGT
 
. : . : . : . : . : . :
JMFN034D24+ CGGTGCTGATAATAGTATTGCCCCGTATGTGGTGATGGGTGGAGGATAGTATGGCCGGTG
JMFN034D22+ TGGTGCTGATAATAGTATTG-CCCGTATGTGTTGATGGGTGGAGGATAGTATGGCCTGTG
                      ____________________________________________________________
consensus TGGTGCTGATAATAGTATTGCCCCGTATGTGTTGATGGGTGGAGGATAGTATGGCCTGTG
 
. : . : . : . : . : . :
JMFN034D24+ GGGCATAGCCATGCCCATCATCGGATGCGGTGGTTGTAGATGCGGCGGCATCATAAGCAT
JMFN034D22+ GGGCATAACCATGCCCATCATCGGATGCGGTTGTTGTAGATGCGGCGGCATCATAAGCAT
                      ____________________________________________________________
consensus GGGCATAGCCATGCCCATCATCGGATGCGGTTGTTGTAGATGCGGCGGCATCATAAGCAT
 
. : . : . : . : . : . :
JMFN034D24+ C
JMFN034D22+ CGGATGCGGCTGAGCCTGCGGCGGCGCCGCCACCACCACCGCCGCAGCTTCGCCCTTCTT
                      ____________________________________________________________
consensus CGGATGCGGCTGAGCCTGCGGCGGCGCCGCCACCACCACCGCCGCAGCTTCGCCCTTCTT
 
. : . : . : . : . : . :
JMFN034D22+ CTCCCCTTCCTTCTTACCTTCTTCCTTTTTCCCTTCTTCCTTTTTGCCTTCCTCTTTAGG
                      ____________________________________________________________
consensus CTCCCCTTCCTTCTTACCTTCTTCCTTTTTCCCTTCTTCCTTTTTGCCTTCCTCTTTAGG