Previous Contig 002612:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN033E13Sequence630002612 (2)sp|Q43043|PME_PETIN2e-52Pectinesterase precursor (EC 3.1.1.11) (Pectin methylesterase) (PE).>pir|S78041|
JMFN039P23Sequence629002612 (2)sp|Q43043|PME_PETIN1e-41Pectinesterase precursor (EC 3.1.1.11) (Pectin methylesterase) (PE).>pir|S78041|

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN039P23+ CAATGAAATGAATGAGCCAAACAAGTGGTTAGTTTGCTC
                      ____________________________________________________________
consensus CAATGAAATGAATGAGCCAAACAAGTGGTTAGTTTGCTC
 
. : . : . : . : . : . :
JMFN039P23+ CTCCTATATATCTACTCGATAGTAGGTTATAGTATAAGTAGGTTGATCGGATCGGAGATG
                      ____________________________________________________________
consensus CTCCTATATATCTACTCGATAGTAGGTTATAGTATAAGTAGGTTGATCGGATCGGAGATG
 
. : . : . : . : . : . :
JMFN039P23+ GGAGTGGGAGTAGGATGAAATCCTTGCTCGGGTGTGATGATAGCTAGCTTAGGTTGCTTA
JMFN033E13+ TAGGATGAAATCCTTGCTCGGGTGTGATGATAGCTAGCTTAGGTTGCTTA
                      ____________________________________________________________
consensus GGAGTGGGAGTAGGATGAAATCCTTGCTCGGGTGTGATGATAGCTAGCTTAGGTTGCTTA
 
. : . : . : . : . : . :
JMFN039P23+ TTCTACGGCCGTACATATCCAGAAGAAAAAGGGATCCCGGCGCGCCCGAGCCATTCATCA
JMFN033E13+ TTCTACGGCCGTACATATCCAGAAGAAAAAGGGATCCCGGCGCGCCCGAGCCATTCATCA
                      ____________________________________________________________
consensus TTCTACGGCCGTACATATCCAGAAGAAAAAGGGATCCCGGCGCGCCCGAGCCATTCATCA
 
. : . : . : . : . : . :
JMFN039P23+ GCCAACATGAACAGTCCAGGAGTAAACTGCTTAGCAACCTCTGGAGAAATGTTCCTCTTG
JMFN033E13+ GCCAACATGAACAGTCCAGGAGTAAACTGCTTAGCAACCTCTGGAGAAATGTTCCTCTTG
                      ____________________________________________________________
consensus GCCAACATGAACAGTCCAGGAGTAAACTGCTTAGCAACCTCTGGAGAAATGTTCCTCTTG
 
. : . : . : . : . : . :
JMFN039P23+ TAACCCTTCCAATTCACCCTTTTAGCGGTTGAAGCTCCTGGGCCGCGGTTTTTATACTCT
JMFN033E13+ TAACCCTTCCAATTCACCCTTTTAGCGGTTGAAGCTCCTGGGCCGCGGTTTTTATACTCT
                      ____________________________________________________________
consensus TAACCCTTCCAATTCACCCTTTTAGCGGTTGAAGCTCCTGGGCCGCGGTTTTTATACTCT
 
. : . : . : . : . : . :
JMFN039P23+ GCATACCAGCAAGTGTCCAGTGCAAACTCGCCCTGCCATATAGACCAACCTTCTGGGACG
JMFN033E13+ GCGTACCAGCAAGTGTCCAGTGCAAACTCGCCCTGCCATATAGACCAACCTTCTGGGACG
                      ____________________________________________________________
consensus GCGTACCAGCAAGTGTCCAGTGCAAACTCGCCCTGCCATATAGACCAACCTTCTGGGACG
 
. : . : . : . : . : . :
JMFN039P23+ ACGATGTTGTCAATGAAAGAGAACATGATGATTGTCCTGGAGAACTCCTTCCATGGCCTC
JMFN033E13+ ACGATGTTGTCAATGAAAGAGAACATGATGATTGTCCTGGAGAACTCCTTCCATGGCCTC
                      ____________________________________________________________
consensus ACGATGTTGTCAATGAAAGAGAACATGATGATTGTCCTGGAGAACTCCTTCCATGGCCTC
 
. : . : . : . : . : . :
JMFN039P23+ CCGAGGAACACTTTGTTGGGTGGGTTGGCGGCCTTCAGGGCGGGTTCAGCGACGATGTCG
JMFN033E13+ CCGAGGAACACTTTGTTGGGTGGGTTGGCGGCCTTCAGGGCGGGTTCAGCGACGATGTCG
                      ____________________________________________________________
consensus CCGAGGAACACTTTGTTGGGTGGGTTGGCGGCCTTCAGGGCGGGTTCAGCGACGATGTCG
 
. : . : . : . : . : . :
JMFN039P23+ CAGGATTGGATGACAATGGCGCTTGCTCCTCGCCTGTCCTTTCTACCTTGAGCGGTCACC
JMFN033E13+ CAGGATTGGATGACAATGGCGCTTGCTCCTCGCCTGTCCTTTCTACCTTGAGCGGTCACC
                      ____________________________________________________________
consensus CAGGATTGGATGACAATGGCGCTTGCTCCTCGCCTGTCCTTTCTACCTTGAGCGGTCACC
 
. : . : . : . : . : . :
JMFN039P23+ ATGCACGCCTGGTTGGCCAATGGCTTCCTCACCACCATCTTGCATTTCTG
JMFN033E13+ ATGCACGCCTGGTTGGCCAATGGCTTCCTCACCACCATCTTGCATTTCTGGAACACGACA
                      ____________________________________________________________
consensus ATGCACGCCTGGTTGGCCAATGGCTTCCTCACCACCATCTTGCATTTCTGGAACACGACA
 
. : . : . : . : . : . :
JMFN033E13+ GGGGCATTCCCGAAGATGAAGTCGACGGTGCCGCTGATGGTGCAGCCGCGGTAGAACTGG
                      ____________________________________________________________
consensus GGGGCATTCCCGAAGATGAAGTCGACGGTGCCGCTGATGGTGCAGCCGCGGTAGAACTGG