Previous Contig 002609:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002D10Sequence586004975 (10)gb:CPL306960_16486531e-54Craterostigma plantagineum mRNA for aldehyde dehydrogenase (ALDH gene).756002609 (8)gb:AY084648_15697362e-83Arabidopsis thaliana clone 1141 mRNA, complete sequence.
JMFF010B05Sequence576004975 (10)gb:CPL306960_16486533e-43Craterostigma plantagineum mRNA for aldehyde dehydrogenase (ALDH gene).790002609 (8)gb:AY084648_15697368e-93Arabidopsis thaliana clone 1141 mRNA, complete sequence.
JMFF017B02Sequence582004975 (10)gb:CPL306960_16486534e-44Craterostigma plantagineum mRNA for aldehyde dehydrogenase (ALDH gene).771002609 (8)gb:AY084648_15697363e-85Arabidopsis thaliana clone 1141 mRNA, complete sequence.
JMFF040F11Sequence526004975 (10)gb:CPL306960_16486533e-42Craterostigma plantagineum mRNA for aldehyde dehydrogenase (ALDH gene).122002609 (8)gb:CPL306960_16486533e-11Craterostigma plantagineum mRNA for aldehyde dehydrogenase (ALDH gene).
JMFF048B13Sequence268004975 (10)gb:CPL306960_16486538e-06Craterostigma plantagineum mRNA for aldehyde dehydrogenase (ALDH gene).376002609 (8)gb:AY084648_15697361e-28Arabidopsis thaliana clone 1141 mRNA, complete sequence.
JMFN032P23Sequence516002609 (8)gb:ATH306961_15524615e-43Arabidopsis thaliana mRNA for aldehyde dehydrogenase (ALDH3 gene).
JMSF004K23Sequence384004975 (10)gb:CPL306960_16486531e-16Craterostigma plantagineum mRNA for aldehyde dehydrogenase (ALDH gene).361002609 (8)gb:AY054633_15632873e-13Arabidopsis thaliana putative aldehyde dehydrogenase (At4g34240; F10M10.10) mRNA
JMSF008E19Sequence452004975 (10)gb:CPL306960_16486538e-19Craterostigma plantagineum mRNA for aldehyde dehydrogenase (ALDH gene).746002609 (8)gb:AY084648_15697363e-87Arabidopsis thaliana clone 1141 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF010B05+ TTATTGCAGNCAAGTGGGGCTG
                      ____________________________________________________________
consensus TTATTGCAGNCAAGTGGGGCTG
 
. : . : . : . : . : . :
rJMSF008E19+ TGTATTGCCCCTGATTACATCATTACTACAAAAGAGAATGCACT
rJMFF010B05+ CANCAGTGGACAAGCTTGTATTGCCCCTGATTACATCATTACTACAAAAGAGAATGCACT
rJMFF017B02+ TGTATTGCCCGTGATTACATCATTACTACAAAAGAGAATGCACT
rJMFF002D10+ TTACATCATTACTACAAAAGAGAATGCACT
                      ____________________________________________________________
consensus CANCAGTGGACAAGCTTGTATTGCCCCTGATTACATCATTACTACAAAAGAGAATGCACT
 
. : . : . : . : . : . :
rJMSF008E19+ ACAGTTGCTTGATGCCATGAAAGTAGAACTAGATAAATTCTATGGAAAGGACCCATTATG
rJMFF010B05+ ACAGTTGCTTGATGCCATGAAAGTAGAACTAGATAAATTCTATGGAAAGGACCCATTATG
rJMFF017B02+ ACAGTTGCTTGATGCCATGAAAGTAGAACTAGATAAATTCTATGGAAAGGACCCATTATG
rJMFF002D10+ ACAGTTGCTTGATGCCATGAAAGTAGAACTAGATAAATTCTATGGAAAGGACCCATTATG
                      ____________________________________________________________
consensus ACAGTTGCTTGATGCCATGAAAGTAGAACTAGATAAATTCTATGGAAAGGACCCATTATG
 
. : . : . : . : . : . :
rJMSF008E19+ TTCAAAAGATCTGTCTCGCATTGTAAATTCCAATCACTTCTCCCGCTTAACAAAGTTACT
rJMFF010B05+ TTCAAAAGATCTGTCTCGCATTGTAAATTCCAATCACTTCTCCCGCTTAACAAAGTTACT
rJMFF017B02+ TTCAAAAGATCTGTCTCGCATTGTAAATTCCAATCACTTCTCCCGCTTAACAAAGTTACT
rJMFF002D10+ TTCAAAAGATCTGTCTCGCATTGTAAATTCCAATCACTTCTCCCGCTTAACAAAGTTACT
                      ____________________________________________________________
consensus TTCAAAAGATCTGTCTCGCATTGTAAATTCCAATCACTTCTCCCGCTTAACAAAGTTACT
 
. : . : . : . : . : . :
rJMSF008E19+ AGATGATGATAAGGTTTCAGGTAAGATAGTCCATGGAGGTGAACGAGATGAAAAGAGACT
rJMFF010B05+ AGATGATGATAAGGTTTCAGGTAAGATAGTCCATGGAGGTGAACGAGATGAAAAGAGACT
rJMFF017B02+ AGATGATGATAAGGTTTCAGGTAAGATAGTCCATGGAGGTGAACGAGATGAAAAGAGACT
rJMFF002D10+ AGATGATGATAAGGTTTCAGGTAAGATAGTCCATGGAGGTGAACGAGATGAAAAGAGACT
                      ____________________________________________________________
consensus AGATGATGATAAGGTTTCAGGTAAGATAGTCCATGGAGGTGAACGAGATGAAAAGAGACT
 
. : . : . : . : . : . :
rJMSF008E19+ AAAGATTGCTCCTACCATTTTGATGGATGTGCCAGAAGACGCCCTAATCATGAAAGAGGA
rJMFF010B05+ AAAGATTGCTCCTACCATTTTGATGGATGTGCCAGAAGACGCCCTAATCATGAAAGAGGA
rJMFF017B02+ AAAGATTGCTCCTACCATTTTGATGGATGTGCCAGAAGACGCCCTAATCATGAAAGAGGA
rJMFF002D10+ AAAGATTGCTCCTACCATTTTGATGGATGTGCCAGAAGACGCCCTAATCATGAAAGAGGA
                      ____________________________________________________________
consensus AAAGATTGCTCCTACCATTTTGATGGATGTGCCAGAAGACGCCCTAATCATGAAAGAGGA
 
. : . : . : . : . : . :
rJMSF008E19+ AATATTTGGTCCTCTACTTCCTATTCTCACAGTCAATAAAGTGGAGGACGGTATAAAAAT
rJMFF010B05+ AATATTTGGTCCTCTACTTCCTATTCTCACAGTCAATAAAGTGGAGGACGGTATAAAAAT
rJMFF017B02+ AATATTTGGTCCTCTACTTCCTATTCTCACAGTCAATAAAGTGGAGGACGGTATAAAAAT
rJMFF002D10+ AATATTTGGTCCTCTACTTCCTATTCTCACAGTCAATAAAGTGGAGGACGGTATAAAAAT
JMFN032P23- TTCTCACAGTCAATAAAGTGGAGGACGGTATAAAAAT
                      ____________________________________________________________
consensus AATATTTGGTCCTCTACTTCCTATTCTCACAGTCAATAAAGTGGAGGACGGTATAAAAAT
 
. : . : . : . : . : . :
rJMSF008E19+ CATTAACGCTAGAGACAAGCCACTTGCAGCATATCTGTTCACAAGCAACAAAAAACTGGA
rJMFF010B05+ CATTAACGCTAGAGACAAGCCACTTGCAGCATATCTGTTCACAAGCAACAAAAAACTGGA
rJMFF017B02+ CATTAACGCTAGAGACAAGCCACTTGCAGCANTTCTGTTCACAAGCAACAAAAAACTGGA
rJMFF002D10+ CATTAACGCTAGAGACAAGCCACTTGCAGCATATCTGTTCACAAGCAACAAAAAACTGGA
rJMSF004K23+ GCAGCATATCTGTTCNCAAGCAGCANAAACCNGGA
JMFN032P23- CATTAACGCTAGAGACAAGCCACTTGCAGCATATCTGTTCACAAGCAACAAAAAACTGGA
                      ____________________________________________________________
consensus CATTAACGCTAGAGACAAGCCACTTGCAGCATATCTGTTCACAAGCAACAAAAAACTGGA
 
. : . : . : . : . : . :
rJMSF008E19+ GCAGGAGTTTGTTACAAATTTATCAGCTGGGGGCTT-GCTTATTAATGACACAGCTTTGC
rJMFF010B05+ GCAGGAGTTTGTTACAAATTTATCAGCTGGGGGCTT-GCTTATTAATGACACAGCTTTGC
rJMFF017B02+ GCAGGAGTTTGTTACAAATTTATCAGCTGGGGGCTT-GCTTATTAATGACACAGCTTTGC
rJMFF002D10+ GCAGGAGTTTGTTACAAATTTATCAGCTGGGGGCTT-GCTTATTAATGACACAGCTTTGC
rJMFF048B13+ AAATTTATCAGCTGGGGGCTT-GCTTATTAATGACACAGCTTTGC
rJMSF004K23+ GCAGGAGTGTGTTACNAATTTNTCAGCTGGGGGCTTNGCTTATTAATGACACAGCTTTGC
JMFN032P23- GCAGGAGTTTGTTACAAATTTATCAGCTGGGGGCTT-GCTTATTAATGACACAGCTTTGC
                      ____________________________________________________________
consensus GCAGGAGTTTGTTACAAATTTATCAGCTGGGGGCTT-GCTTATTAATGACACAGCTTTGC
 
. : . : . : . : . : . :
rJMSF008E19+ ATGTTGCAGTCCACACGCTGCCGTTTGGAGGAGTAGGAGAAAGCGGAACAGGTTCATACC
rJMFF010B05+ ATGTTGCAGTCCACACGCTGCCGTTTGGAGGAGTAGGAGAAAGCGGAACAGGTTCATACC
rJMFF017B02+ ATGTTGCAGTCCACACGCTGCCGTTTGGAGGAGTAGGAGAAAGCGGAACAGGTTCATACC
rJMFF002D10+ ATGTTGCAGTCCACACGCTGCCGTTTGCAGGAGTAGGAGAAAGCGGAACAGGTTCATACC
rJMFF048B13+ ATGTTGCAGTCCACACGCTGCCGTTTGGAGGAGTAGGAGAAAGCGGAACAGGTTCATACC
rJMSF004K23+ ATGTTGCAGTCCACACGNTGCCGNTNGGAGGAGTAGGAGAAAGCGGAACAGGTTCATACC
rJMFF040F11+ GCCGTTTGGNGGAGTAGGAGAAAGNGGAACAGGTTCATACC
JMFN032P23- ATGTTGCAGTCCACACGCTGCCGTTTGGAGGAGTAGGAGAAAGCGGAACAGGTTCATACC
                      ____________________________________________________________
consensus ATGTTGCAGTCCACACGCTGCCGTTTGGAGGAGTAGGAGAAAGCGGAACAGGTTCATACC
 
. : . : . : . : . : . :
rJMSF008E19+ ATGGCAAATTCTCGTTTGAAGCTTTCAGCCACAAGAAGGCAGTCCTGAAACGTAGTTTTG
rJMFF010B05+ ATGGCAAATTCTCGTTTGAAGCTTTCAGCCACAAGAAGGCAGTCCTGAAACGTAGTTTTG
rJMFF017B02+ ATGGCAAATTCTCGTTTGAAGCTTTCAGCCACAAGAAGGCAGTCCTGAAACGTAGTTTTG
rJMFF002D10+ ATGGCAAATTCTCGTTTGAAGCTTTCAGCCACAAGAAGGCAGTCCTGAAACGTAGTTTTG
rJMFF048B13+ ATGGCAAATTCTCGTTTGAAGCTTTCAGCCACAAGAAGGCAGTCCTGAAACGTAGTTTTG
rJMSF004K23+ ATGGCAAATTCTCGTTTGAAGCTTTCAGCCACANGANGGCAGTCNTGAAACGTAGTTTTG
rJMFF040F11+ ATGGCAAATTCTCGTTTGAAGCTTTCAGCCACNNGAAGGCAGTCNTGAAACGTAGTTTTG
JMFN032P23- ATGGCAAATTCTCGTTTGAAGCTTTCAGCCACAAGAAGGCAGTCCTGAAACGTAGTTTTG
                      ____________________________________________________________
consensus ATGGCAAATTCTCGTTTGAAGCTTTCAGCCACAAGAAGGCAGTCCTGAAACGTAGTTTTG
 
. : . : . : . : . : . :
rJMSF008E19+ GTGGAGATTTGGGTGCAAGATACCCACCCTATACACCTAAGAAGGCACGACTTCTGAGAG
rJMFF010B05+ GTGGAGATTTGGGTGCAAGATACCCACCCTATACACCTAAGAAGGCACGACTTCTGAGAG
rJMFF017B02+ GTGGAGATTTGGGTGCAAGATACCCACCCTATACACCTAAGAAGGCACGACTTCTGAGAG
rJMFF002D10+ GTGGAGATTTGGGTGCAAGATACCCACCCTATACACCTAAGAAGGCACGACTTCTGAGAG
rJMFF048B13+ GTGGAGATTTGGGTGCAAGATACCCACCCTATACACCTAAGAAGGCACGACTTCTGAGAG
rJMSF004K23+ GTGNAGATTNGGGTGCAAGATACCCNCCCTATACACNTAAGAAGGCACNACTTCTGAGAG
rJMFF040F11+ GTGGAGATTNGGGTNCAAGAT
JMFN032P23- GTGGAGATTTGGGTGCAAGATACCCACCCTATACACCTAAGAAGGCACGACTTCTGAGAG
                      ____________________________________________________________
consensus GTGGAGATTTGGGTGCAAGATACCCACCCTATACACCTAAGAAGGCACGACTTCTGAGAG
 
. : . : . : . : . : . :
rJMSF008E19+ CACTAATGAGTGGAAATCTGATTTTCATAATTCGCGCATTACTTGGCTTGTAAATATATG
rJMFF010B05+ CACTAATGAGTGGAAATCTGATTTTCATAATTCGCGCATTACTTGGCTTGTAAATATATG
rJMFF017B02+ CACTAATGAGTGGAAATCTGATTTTCATAATTCGCGCATTACTTGGCTTGTAAATATATG
rJMFF002D10+ CACTAATGAGTGGAAATCTGATTTTCATAATTCGCGCATTACTTGGCTTGTAAATATATG
rJMFF048B13+ CACTAATGAGTGGAAATCTGATTTTCATAATTCGCGCATTACTTGGCTTGTAAATATATG
rJMSF004K23+ CACTAATGAGTNGAAATCTGATTTTCATAATTCGCGCANTACNTNGCTTGTAAATATATG
JMFN032P23- CACTAATGAGTGGAAATCTGATTTTCATAATTCGCGCATTACTTGGCTTGTAAATATATG
                      ____________________________________________________________
consensus CACTAATGAGTGGAAATCTGATTTTCATAATTCGCGCATTACTTGGCTTGTAAATATATG
 
. : . : . : . : . : . :
rJMSF008E19+ TTGTTTATATTTGGGACCCCCAAATTGTTGAAACTTGAATAAT
rJMFF010B05+ TTGTTTATATTTGGGACCCCCAAATTGTTGAAACTTGAATAATTGTTGT
rJMFF017B02+ TTGTTTATATTTGGGACCCCCAAATTGTTGAAACTTGAATAATTGTTGTTTGTCCATATT
rJMFF002D10+ TTGTTTATATTTGGGACCCCCAAATTGTTGAAACTTGAATAATTGTTGTTTGTCCATATT
rJMFF048B13+ TTGTTTATATTTGGGACCCCCAAATTGTTGAAACTTGAATAATTGTTGTTTGTCCATATT
rJMSF004K23+ TTGTNTATATTTGGGACCCCCAAATT
JMFN032P23- TTGTTTATATTTGGGACCCCCAAATTGTTGAAACTTGAATAATTGTTGTTTGTCCATATT
                      ____________________________________________________________
consensus TTGTTTATATTTGGGACCCCCAAATTGTTGAAACTTGAATAATTGTTGTTTGTCCATATT
 
. : . : . : . : . : . :
rJMFF017B02+ GTGATAT
rJMFF002D10+ GTGATAT
rJMFF048B13+ GTGATATTGTTGAATGCATGTGAACTTAAGAC
JMFN032P23- GTGATATTGTTGAATGCATGTGAACTTAAGACATTGAAAGTTTAGTGGTATATTTGATTT
                      ____________________________________________________________
consensus GTGATATTGTTGAATGCATGTGAACTTAAGACATTGAAAGTTTAGTGGTATATTTGATTT