Previous Contig 002606:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN006G11Sequence567002606 (15)sp|P46301|RS25_LYCES5e-3040S ribosomal protein S25.>pir|S40089|S40089 ribosomal protein S25, cytosolic -
JMFN008A01Sequence592002606 (15)sp|P46301|RS25_LYCES5e-3040S ribosomal protein S25.>pir|S40089|S40089 ribosomal protein S25, cytosolic -
JMFN012B03Sequence570002606 (15)sp|P46301|RS25_LYCES5e-3040S ribosomal protein S25.>pir|S40089|S40089 ribosomal protein S25, cytosolic -
JMFN012G24Sequence593002606 (15)sp|P46301|RS25_LYCES6e-3040S ribosomal protein S25.>pir|S40089|S40089 ribosomal protein S25, cytosolic -
JMFN015L09Sequence615002606 (15)sp|P46301|RS25_LYCES6e-3040S ribosomal protein S25.>pir|S40089|S40089 ribosomal protein S25, cytosolic -
JMFN016C21Sequence578002606 (15)sp|P46301|RS25_LYCES5e-3040S ribosomal protein S25.>pir|S40089|S40089 ribosomal protein S25, cytosolic -
JMFN032J13Sequence527002606 (15)sp|P46301|RS25_LYCES4e-3040S ribosomal protein S25.>pir|S40089|S40089 ribosomal protein S25, cytosolic -
JMFN032M14Sequence566002606 (15)sp|P46301|RS25_LYCES5e-3040S ribosomal protein S25.>pir|S40089|S40089 ribosomal protein S25, cytosolic -
JMFN035K01Sequence609002606 (15)sp|P46301|RS25_LYCES6e-3040S ribosomal protein S25.>pir|S40089|S40089 ribosomal protein S25, cytosolic -
JMFN039D19Sequence593002606 (15)sp|P46301|RS25_LYCES6e-3040S ribosomal protein S25.>pir|S40089|S40089 ribosomal protein S25, cytosolic -
JMFN040L05Sequence563002606 (15)sp|P46301|RS25_LYCES5e-3040S ribosomal protein S25.>pir|S40089|S40089 ribosomal protein S25, cytosolic -
JMFN042O18Sequence584002606 (15)sp|P46301|RS25_LYCES5e-3040S ribosomal protein S25.>pir|S40089|S40089 ribosomal protein S25, cytosolic -
JMFS040G06Sequence554002606 (15)sp|P46301|RS25_LYCES5e-3040S ribosomal protein S25.>pir|S40089|S40089 ribosomal protein S25, cytosolic -
JMSF025D20Sequence612002606 (15)sp|P46301|RS25_LYCES6e-3040S ribosomal protein S25.>pir|S40089|S40089 ribosomal protein S25, cytosolic - 565002606 (15)sp|P46301|RS25_LYCES5e-3040S ribosomal protein S25.>pir|S40089|S40089 ribosomal protein S25, cytosolic -

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN035K01+ AGAATGCCAATAAATCGATAT
JMFN016C21+ AT
JMFN012G24+ TGCCAATAAATCGATAT
JMFN039D19+ AGAATGCCAATAAATCGATAT
JMFN042O18+ AGAATGCCAATAAATCGATAT
JMFN008A01+ AGAATGCCAATAAATCGATAT
JMFS040G06+ AGAATGCCAATAAATCGATAT
JMFN006G11+ AGAATGCCAATAAATCGATAT
JMFN015L09+ TTTTTTAATTAGAATGCCAATAATNCGATAT
JMSF025D20+ GATAT
                      ____________________________________________________________
consensus TTTTTTAATTAGAATGCCAATAAATCGATAT
 
. : . : . : . : . : . :
JMFN035K01+ TAAAGAGCAAGAAATGACTGNAAGAAAACCATTTGCTCGAAGTAGCAA-AAAATCTTGAT
JMFN016C21+ TAAAGAGCAAGAAATGACTTGAAGAAAACCATTTGCTCGAAGTAGCAACAAAATCTTGAT
JMFN012G24+ TAAAGAGCAAGAAATGACTTGAAGAAAACCATTTGCTCGAAGTAGCAACAAAATCTTGAT
JMFN039D19+ TAAAGAGCAAGAAATGACTTGAAGAAAACCATTTGCTCGAAGTAGCAACAAAATCTTGAT
JMFN042O18+ TAAAGAGCAAGAAATGACTGNAAGAAAACCATTTGCTCGAAGTAGCAACAAAATCTTGAT
JMFN012B03+ AAAGAGCAAGAAATGACTTGAAGAAAACCATTTGCTCGAAGTAGCAACAAAATCTTGAT
JMFN032J13+ GAAGAAAACCATTTGCTCGAAGTAGCAACAAAATCTTGAT
JMFN008A01+ TAAAGAGCAAGAAATGACTTGAAGAAAACCATTTGCTCGAAGTAGCAACAAAATCTTGAT
JMFS040G06+ TAAAGAGCAAGAAATGACTTGAAGAAAACCATTTGCTCGAAGTAGCAACAAAATCTTGAT
JMFN006G11+ TAAAGAGCAAGAAATGACTTGAAGAAAACCATTTGCTCGAAGTAGCAACAAAATCTTGAT
JMFN015L09+ TAAAGAGCAAGAAATGACTTGAAGAAAACCATTTGCTCGAAGTAGCAA-AAAATCTTGAT
rJMSF025D20- TTGCTCGAAGTAGCAACAAAATCTTGAT
JMFN040L05+ AGAAAACCATTTGCTCGAAGTAGCAACAAAATCTTGAT
JMSF025D20+ TAAAGAGCAAGAAATGACTTGAAGAAAACCATTTGCTCGAAGTAGCAACAAAATCTTGAT
JMFN032M14+ GCTCGAAGTAGCAACAAAATCTTGAT
                      ____________________________________________________________
consensus TAAAGAGCAAGAAATGACTTGAAGAAAACCATTTGCTCGAAGTAGCAACAAAATCTTGAT
 
. : . : . : . : . : . :
JMFN035K01+ AACTCCACATTTGTGAAAATGAGAAGACAAATGGCTAACTGAAAACACAATAGATATAGA
JMFN016C21+ AACTCCACATTTGTGAAAATGAGAAGACAAATGGCTAACTGAAAACACAATAGATATAGA
JMFN012G24+ AACTCCACATTTGTGAAAATGAGAAGACAAATGGCTAACTGAAAACACAATAGATATAGA
JMFN039D19+ AACTCCACATTTGTGAAAATGAGAAGACAAATGGCTAACTGAAAACACAATAGATATAGA
JMFN042O18+ AACTCCACATTTGTGAAAATGAGAAGACAAATGGCTAACTGAAAACACAATAGATATAGA
JMFN012B03+ AACTCCACATTTGTAAAAATGAGAAGACAAATGGCTAACTGAAAACACAATAGATATAGA
JMFN032J13+ AACTCCACATTTGTGAAAATGAGAAGACAAATGGCTAACTGAAAACACAATAGATATAGA
JMFN008A01+ AACTCCACATTTGTGAAAATGAGAAGACAAATGGCTAACTGAAAACACAATAGATATAGA
JMFS040G06+ AACTCCACATTTGTGAAAATGAGAAGACAAATGGCTAACTGAAAACACAATAGATATAGA
JMFN006G11+ AACTCCACATTTGTGAAAATGAGAAGACAAATGGCTAACTGAAAACACAATAGATATAGA
JMFN015L09+ AACTCCACATTTGTGAAAATGAGAAGACAAATGGCTAACTGAAAACACAATAGATATAGA
rJMSF025D20- AACTCCACATTTGTGAAAATGAGAAGACAAATGGCTAACTGAAAACACAATAGATATAGA
JMFN040L05+ AACTCCACATTTGTGAAAATGAGAAGACAAATGGCTAACTGAAAACACAATAGATATAGA
JMSF025D20+ AACTCCACATTTGTGAAAATGAGAAGACAAATGGCTAACTGAAAACACAATAGATATAGA
JMFN032M14+ AACTCCACATTTGTGAAAATGAGAAGACAAATGGCTAACTGAAAACACAATAGATATAGA
                      ____________________________________________________________
consensus AACTCCACATTTGTGAAAATGAGAAGACAAATGGCTAACTGAAAACACAATAGATATAGA
 
. : . : . : . : . : . :
JMFN035K01+ TGGAGTCTAATAAGAGAGAGAACCCATGAATGAGCCCTCCATTCAACTAAAAGTCCAAAA
JMFN016C21+ TGGAGTCTAATAAGAGAGAGAACCCATGAATGAGCTCTCCATTCAACTAAAAGTCCAAAA
JMFN012G24+ TGGAGTCTAATAAGAGAGAGAACCCATGAATGAGCCCTCCATTCAACTAAAAGTCCAAAA
JMFN039D19+ TGGAGTCTAATAAGAGAGAGAACCCATGAATGAGCCCTCCATTCAACTAAAAGTCCAAAA
JMFN042O18+ TGGAGTCTAATAAGAGAGAGAACCCATGAATGAGCCCTCCATTCAACTAAAAGTCCAAAA
JMFN012B03+ TGGAGTCTAATAAGAGAGAGAACCCATGAATGAGCCCTCCATTCAACTAAAAGTCCAAAA
JMFN032J13+ TGGAGTCTAATAAGAGAGAGAACCCATGAATGAGCCCTCCATTCAACTAAAAGTCCAAAA
JMFN008A01+ TGGAGTCTAATAAGAGAGAGAACCCATGAATGAGCCCTCCATTCAACTAAAAGTCCAAAA
JMFS040G06+ TGGAGTCTAATAAGAGAGAGAACCCATGAATGAGCCCTCCATTCAACTAAAAGTCCAAAA
JMFN006G11+ TGGAGTCTAATAAGAGAGAGAACCCATGAATGAGCCCTCCATTCAACTAAAAGTCCAAAA
JMFN015L09+ TGGAGTCTAATAAGAGAGAGAACCCATGAATGAGCCCTCCATTCAACTAAAAGTCCAAAA
rJMSF025D20- TGGAGTCTAATAAGAGAGAGAACCCATGAATGAGCCCTCCATTCAACTAAAAGTCCAAAA
JMFN040L05+ TGGAGTCTAATAAGAGAGAGAACCCATGAATGAGCCCTCCATTCAACTAAAAGTCCAAAA
JMSF025D20+ TGGAGTCTAATAAGAGAGAGAACCCATGAATGAGCCCTCCATTCAACTAAAAGTCCAAAA
JMFN032M14+ TGGAGTCTAATAAGAGAGAGAACCCATGAATGAGCCCTCCATTCAACTAAAAGTCCAAAA
                      ____________________________________________________________
consensus TGGAGTCTAATAAGAGAGAGAACCCATGAATGAGCCCTCCATTCAACTAAAAGTCCAAAA
 
. : . : . : . : . : . :
JMFN035K01+ CTTAGGTATTGGTTGCTCTAGTGTATATCTGCTGGCTGGCATGAGCTGACACCATCCTGA
JMFN016C21+ CTTAGGTATTGGTTGCTCTAGTGTATATCTGCTGGCTGGCATGAGCTGACACCATCCTGA
JMFN012G24+ CTTAGGTATTGGTTGCTCTAGTGTATATCTGCTGGCTGGCATGAGCTGACACCATCCTGA
JMFN039D19+ CTTAGGTATTGGTTGCTCTAGTGTATATCTGCTGGCTGGCATGAGCTGACACCATCCTGA
JMFN042O18+ CTTAGGTATTGGTTGCTCTAGTGTATATCTGCTGGCTGGCATGAGCTGACACCATCCTGA
JMFN012B03+ CTTAGGTATTGGTTGCTCTAGTGTATATCTGCTGGCTGGCATGAGCTGACACCATCCTGA
JMFN032J13+ CTTAGGTATTGGTTGCTCTAGTGTATATCTGCTGGCTGGCATGAGCTGACACCATCCTGA
JMFN008A01+ CTTAGGTATTGGTTGCTCTAGTGTATATCTGCTGGCTGGCATGAGCTGACACCATCCTGA
JMFS040G06+ CTTAGGTATTGGTTGCTCTAGTGTATATCTGCTGGCTGGCATGAGCTGACACCATCCTGA
JMFN006G11+ CTTAGGTATTGGTTGCTCTAGTGTATATCTGCTGGCTGGCATGAGCTGACACCATCCTGA
JMFN015L09+ CTTAGGTATTGGTTGCTCTAGTGTATATCTGCTGGCTGGCATGAGCTGACACCATCCTGA
rJMSF025D20- CTTAGGTATTGGTTGCTCTAGTGTATATCTGCTGGCTGGCATGAGCTGACACCATCCTGA
JMFN040L05+ CTTAGGTATTGGTTGCTCTAGTGTATATCTGCTGGCTGGCATGAGCTGACACCATCCTGA
JMSF025D20+ CTTAGGTATTGGTTGCTCTAGTGTATATCTGCTGGCTGGCATGAGCTGACACCATCCTGA
JMFN032M14+ CTTAGGTATTGGTTGCTCTAGTGTATATCTGCTGGCTGGCATGAGCTGACACCATCCTGA
                      ____________________________________________________________
consensus CTTAGGTATTGGTTGCTCTAGTGTATATCTGCTGGCTGGCATGAGCTGACACCATCCTGA
 
. : . : . : . : . : . :
JMFN035K01+ TCAAGCCTCTGGCCATCAATTCTCTGATTGCCCTTCTAGCAAGTGAACCACTTATCCTGA
JMFN016C21+ TCAAGCCTCTGGCCATCAATTCTCTGATTGCCCTTCTAGCAAGTGAACCACTTATCCTGA
JMFN012G24+ TCAAGCCTCTGGCCATCAATTCTCTGATTGCCCTTCTAGCAAGTGAACCACTTATCCTGA
JMFN039D19+ TCAAGCCTCTGGCCATCAATTCTCTGATTGCCCTTCTAGCAAGTGAACCACTTATCCTGA
JMFN042O18+ TCAAGCCTCTGGCCATCAATTCTCTGATTGCCCTTCTAGCAAGTGAACCACTTATCCTGA
JMFN012B03+ TCAAGCCTCTGGCCATCAATTCTCTGATTGCCCTTCTAGCAAGTGAACCACTTATCCTGA
JMFN032J13+ TCAAGCCTCTGGCCATCAATTCTCTGATTGCCCTTCTAGCAAGTGAACCACTTATCCTGA
JMFN008A01+ TCAAGCCTCTGGCCATCAATTCTCTGATTGCCCTTCTAGCAAGTGAACCACTTATCCTGA
JMFS040G06+ TCAAGCCTCTGGCCATCAATTCTCTGATTGCCCTTCTAGCAAGTGAACCACTTATCCTGA
JMFN006G11+ TCAAGCCTCTGGCCATCAATTCTCTGATTGCCCTTCTAGCAAGTGAACCACTTATCCTGA
JMFN015L09+ TCAAGCCTCTGGCCATCAATTCTCTGATTGCCCTTCTAGCAAGTGAACCACTTATCCTGA
rJMSF025D20- TCAAGCCTCTGGCCATCAATTCTCTGATTGCCCTTCTAGCAAGTGAACCACTTATCCTGA
JMFN040L05+ TCAAGCCTCTGGCCATCAATTCTCTGATTGCCCTTCTAGCAAGTGAACCACTTATCCTGA
JMSF025D20+ TCAAGCCTCTGGCCATCAATTCTCTGATTGCCCTTCTAGCAAGTGAACCACTTATCCTGA
JMFN032M14+ TCAAGCCTCTGGCCATCAATTCTCTGATTGCCCTTCTAGCAAGTGAACCACTTATCCTGA
                      ____________________________________________________________
consensus TCAAGCCTCTGGCCATCAATTCTCTGATTGCCCTTCTAGCAAGTGAACCACTTATCCTGA
 
. : . : . : . : . : . :
JMFN035K01+ GACGGTCGGATAAGACGGAGGGGGTGATAAGTTTGTACTTAGGGGCTTCAGTGAGCAGCT
JMFN016C21+ GACGGTCGGATAAGACGGAGGGGGTGATAAGTTTGTACTTAGGGGCTTCAGTGAGCAGCT
JMFN012G24+ GACGGTCGGATAAGACGGAGGGGGTGATAAGTTTGTACTTAGGGGCTTCAGTGAGCAGCT
JMFN039D19+ GACGGTCGGATAAGACGGAGGGGGTGATAAGTTTGTACTTAGGGGCTTCAGTGAGCAGCT
JMFN042O18+ GACGGTCGGATAAGACGGAGGGGGTGATAAGTTTGTACTTAGGGGCTTCAGTGAGCAGCT
JMFN012B03+ GACGGTCGGATAAGACGGAGGGGGTGATAAGTTTGTACTTAGGGGCTTCAGTGAGCAGCT
JMFN032J13+ GACGGTCGGATAAGACGGAGGGGGTGATAAGTTTGTACTTAGGGGCTTCAGTGAGCAGCT
JMFN008A01+ GACGGTCGGATAAGACGGAGGGGGTGATAAGTTTGTACTTAGGGGCTTCAGTGAGCAGCT
JMFS040G06+ GACGGTCGGATAAGACGGAGGGGGTGATAAGTTTGTACTTAGGGGCTTCAGTGAGCAGCT
JMFN006G11+ GACGGTCGGATAAGACGGAGGGGGTGATAAGTTTGTACTTAGGGGCTTCAGTGAGCAGCT
JMFN015L09+ GACGGTCGGATAAGACGGAGGGGGTGATAAGTTTGTACTTAGGGGCTTCAGTGAGCAGCT
rJMSF025D20- GACGGTCGGATAAGACGGAGGGGGTGATAAGTTTGTACTTAGGGGCTTCAGTGAGCAGCT
JMFN040L05+ GACGGTCGGATAAGACGGAGGGGGTGATAAGTTTGTACTTAGGGGCTTCAGTGAGCAGCT
JMSF025D20+ GACGGTCGGATAAGACGGAGGGGGTGATAAGTTTGTACTTAGGGGCTTCAGTGAGCAGCT
JMFN032M14+ GACGGTCGGATAAGACGGAGGGGGTGATAAGTTTGTACTTAGGGGCTTCAGTGAGCAGCT
                      ____________________________________________________________
consensus GACGGTCGGATAAGACGGAGGGGGTGATAAGTTTGTACTTAGGGGCTTCAGTGAGCAGCT
 
. : . : . : . : . : . :
JMFN035K01+ TGTCGTATGTGGCCTTGTCGAAAAGCACCATGTTGTTAACCTTTTCCTTTTGCTTTCCCT
JMFN016C21+ TGTCGTATGTGGCCTTGTCGAAAAGCACCATGTTGTTAACCTTTTCCTTTTGCTTTCCCT
JMFN012G24+ TGTCGTATGTGGCCTTGTCGAAAAGCACCATGTTGTTAACCTTTTCCTTTTGCTTTCCCT
JMFN039D19+ TGTCGTATGTGGCCTTGTCGAAAAGCACCATGTTGTTAACCTTTTCCTTTTGCTTTCCCT
JMFN042O18+ TGTCGTATGTGGCCTTGTCGAAAAGCACCATGTTGTTAACCTTTTCCTTTTGCTTTCCCT
JMFN012B03+ TGTCGTATGTGGCCTTGTCGAAAAGCACCATGTTGTTAACCTTTTCCTTTTGCTTTCCCT
JMFN032J13+ TGTCGTATGTGGCCTTGTCGAAAAGCACCATGTTGTTAACCTTTTCCTTTTGCTTTCCCT
JMFN008A01+ TGTCGTATGTGGCCTTGTCGAAAAGCACCATGTTGTTAACCTTTTCCTTTTGCTTTCCCT
JMFS040G06+ TGTCGTATGTGGCCTTGTCGAAAAGCACCATGTTGTTAACCTTTTCCTTTTGCTTTCCCT
JMFN006G11+ TGTCGTATGTGGCCTTGTCGAAAAGCACCATGTTGTTAACCTTTTCCTTTTGCTTTCCCT
JMFN015L09+ TGTCGTATGTGGCCTTGTCGAAAAGCACCATGTTGTTAACCTTTTCCTTTTGCTTTCCCT
rJMSF025D20- TGTCGTATGTGGCCTTGTCGAAAAGCACCATGTTGTTAACCTTTTCCTTTTGCTTTCCCT
JMFN040L05+ TGTCGTATGTGGCCTTGTCGAAAAGCACCATGTTGTTAACCTTTTCCTTTTGCTTTCCCT
JMSF025D20+ TGTCGTATGTGGCCTTGTCGAAAAGCACCATGTTGTTAACCTTTTCCTTTTGCTTTCCCT
JMFN032M14+ TGTCGTATGTGGCCTTGTCGAAAAGCACCATGTTGTTAACCTTTTCCTTTTGCTTTCCCT
                      ____________________________________________________________
consensus TGTCGTATGTGGCCTTGTCGAAAAGCACCATGTTGTTAACCTTTTCCTTTTGCTTTCCCT
 
. : . : . : . : . : . :
JMFN035K01+ TGCTCCATTTCTTCTTCTTCTGCTTGCCACCGCCGGACTTGGCGGGCTTCGAAGACGGAG
JMFN016C21+ TGCTCCATTTCTTCTTCTTCTGCTTGCCACCGCCGGACTTGGCAGGCTTCGAAGACGGAG
JMFN012G24+ TGCTCCATTTCTTCTTCTTCTGCTTGCCACCGCCGGACTTGGCGGGCTTCGAAGACGGAG
JMFN039D19+ TGCTCCATTTCTTCTTCTTCTGCTTGCCACCGCCGGACTTGGCGGGCTTCGAAGACGGAG
JMFN042O18+ TGCTCCATTTCTTCTTCTTCTGCTTGCCACCGCCGGACTTGGCGGGCTTCGAAGACGGAG
JMFN012B03+ TGCTCCATTTCTTCTTCTTCTGCTTGCCACCGCCGGACTTGGCGGGCTTCGAAGACGGAG
JMFN032J13+ TGCTCCATTTCTTCTTCTTCTGCTTGCCACCGCCGGACTTGGCGGGCTTCGAAGACGGAG
JMFN008A01+ TGCTCCATTTCTTCTTCTTCTGCTTGCCACCGCCGGACTTGGCGGGCTTCGAAGACGGAG
JMFS040G06+ TGCTCCATTTCTTCTTCTTCTGCTTGCCACCGCCGGACTTGGCGGGCTTCGAAGACGGAG
JMFN006G11+ TGCTCCATTTCTTCTTCTTCTGCTTGCCACCGCCGGACTTGGCGGGCTTCGAAGACGGAG
JMFN015L09+ TGCTCCATTTCTTCTTCTTCTGCTTGCCACCGCCGGACTTGGCGGGCTTCGAAGACGGAG
rJMSF025D20- TGCTCCATTTCTTCTTCTTCTGCTTGCCACCGCCGGACTTGGCGGGCTTCGAAGACGGAG
JMFN040L05+ TGCTCCATTTCTTCTTCTTCTGCTTGCCACCGCCGGACTTGGCGGGCTTCGAAGACGGAG
JMSF025D20+ TGCTCCATTTCTTCTTCTTCTGCTTGCCACCGCCGGACTTGGCGGGCTTCGAAGACGGAG
JMFN032M14+ TGCTCCATTTCTTCTTCTTCTGCTTGCCACCGCCGGACTTGGCGGGCTTCGAAGACGGAG
                      ____________________________________________________________
consensus TGCTCCATTTCTTCTTCTTCTGCTTGCCACCGCCGGACTTGGCGGGCTTCGAAGACGGAG
 
. : . : . : . : . : . :
JMFN035K01+ GTGGAGCCTTTTCCTTCTTCGGCGCCATGGAGGTTTGAAGCGATGAGGAAGACGACGAAC
JMFN016C21+ GTGGAGCCTTTTCCTTCTTCGGCGCCATGGAGGTTTGAAGCGATGAGGAAGACGACGAAC
JMFN012G24+ GTGGAGCCTTTTCCTTCTTCGGCGCCATGGAGGTTTGAAGCGATGAGGAAGACGACGAAC
JMFN039D19+ GTGGAGCCTTTTCCTTCTTCGGCGCCATGGAGGTTTGAAGCGATGAGGAAGACGACGAAC
JMFN042O18+ GTGGAGCCTTTTCCTTCTTCGGCGCCATGGAGGTTTGAAGCGATGAGGAAGACGACGAAC
JMFN012B03+ GTGGAGCCTTTTCCTTCTTCGGCGCCATGGAGGTTTGAAGCGATGAGGAAGACGACGAAC
JMFN032J13+ GTGGAGCCTTTTCCTTCTTCGGCGCCATGGAGGTTTGAAGCGATGAGGAAGACGACGAAC
JMFN008A01+ GTGGAGCCTTTTCCTTCTTCGGCGCCATGGAGGTTTGAAGCGATGAGGAAGACGACGAAC
JMFS040G06+ GTGGAGCCTTTTCCTTCTTCGGCGCCATGGAGGTTTGAAGCGATGAGGAAGAC
JMFN006G11+ GTGGAGCCTTTTCCTTCTTCGGCGCCATGGAGGTTTGAAGCGATGAGGAAGACGACGAAC
JMFN015L09+ GTGGAGCCTTTTCCTTCTTCGGCGCCATGGAGGTTTGAAGCGATGAGGAAGACGACGAAC
rJMSF025D20- GTGGAGCCTTTTCCTTCTTCGGCGCCATGGAGGTTTGAAGCGATGAGGAAGACGACGAAC
JMFN040L05+ GTGGAGCCTTTTCCTTCTTCGGCGCCATGGAGGTTTGAAGCGATGAGGAAGACGACGAAC
JMSF025D20+ GTGGAGCCTTTTCCTTCTTCGGCGCCATGGAGGTTTGAAGCGATGAGGAAGACGACGAAC
JMFN032M14+ GTGGAGCCTTTTCCTTCTTCGGCGCCATGGAGGTTTGAAGCGATGAGGAAGACGACGAAC
                      ____________________________________________________________
consensus GTGGAGCCTTTTCCTTCTTCGGCGCCATGGAGGTTTGAAGCGATGAGGAAGACGACGAAC
 
. : . : . : . : . : . :
JMFN035K01+ GACGGAGGTGGAGGCAGAGAGGACTTCGGAAATAAGTATGATGTG
JMFN016C21+ GACGGAGGTGGAGGCAGAGAGGACTTCGGAAATAAG
JMFN012G24+ GACGGAGGTGGAGGCAGAGAGGACTTCGGAAATAAG
JMFN039D19+ GACGGAGGTGGAGGCAGAGAGGACTTCGGAAA
JMFN042O18+ GACGGAGGTGGAGGCAGAGAGGA
JMFN012B03+ GACGGAGGTGGAGGCAGAGAGGACTTCGGAA
JMFN032J13+ GACGGAG
JMFN008A01+ GACGGAGGTGGAGGCAGAGAGGACTTCGGAA
JMFN006G11+ GACGGA
JMFN015L09+ GACGGAGGTGGAGGCAGAGAGGACTTCGGAAATAAGTATGATGTG
rJMSF025D20- GACGGAGGTGGAGGCAGAGAGGACTTCGGAAATAAGTATGATGTGCTTCGAGCTTC
JMFN040L05+ GACGGAGGTGGAGGCAGAGAGGACTTCGGAAATAAGTATGATGTG
JMSF025D20+ GACGGAGGTGGAGGCAGAGAGGACTTCGGAAATAAGTATGATGTGCTTCGAGCTTC
JMFN032M14+ GACGGAGGTGGAGGCAGAGAGGACTTCGGAAATAAGTATGATGTGCTTCGAGCTTCGAAG
                      ____________________________________________________________
consensus GACGGAGGTGGAGGCAGAGAGGACTTCGGAAATAAGTATGATGTGCTTCGAGCTTCGAAG