Previous Contig 002602:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN009E13Sequence618002602 (3)gb:AY149608_15847776e-93Solanum tuberosum cultivar Kuras cinnamoyl CoA reductase mRNA, complete cds.
JMFN032J08Sequence618002602 (3)gb:AY149608_15847771e-90Solanum tuberosum cultivar Kuras cinnamoyl CoA reductase mRNA, complete cds.
JMSF024E03Sequence618019338gb:A47101_14493972e-41Sequence 7 from Patent WO9527790.>gb:A62308_1449994 Sequence 11 from Patent WO97693002602 (3)gb:AY149608_15847771e-93Solanum tuberosum cultivar Kuras cinnamoyl CoA reductase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF024E03- GTCATCAACA
                      ____________________________________________________________
consensus GTCATCAACA
 
. : . : . : . : . : . :
rJMSF024E03- CAAACTCATATTCATTTTTCCATTTAAATCTTACCCACAACCAAATTTTAGAGTTTTTTT
                      ____________________________________________________________
consensus CAAACTCATATTCATTTTTCCATTTAAATCTTACCCACAACCAAATTTTAGAGTTTTTTT
 
. : . : . : . : . : . :
rJMSF024E03- TTAGAGAAGTTTATGAGTTATGAGCCAATTCGAATTGGTTCATCATTTTGGACGGGGAGA
                      ____________________________________________________________
consensus TTAGAGAAGTTTATGAGTTATGAGCCAATTCGAATTGGTTCATCATTTTGGACGGGGAGA
 
. : . : . : . : . : . :
rJMSF024E03- GGAAGATGACCTTTCTCCTGAAGGCTCTTTACCGTCTCATACAAGCATTGCTTCACTGGA
                      ____________________________________________________________
consensus GGAAGATGACCTTTCTCCTGAAGGCTCTTTACCGTCTCATACAAGCATTGCTTCACTGGA
 
. : . : . : . : . : . :
rJMSF024E03- GTAAACTCCAACCCCAAGTCCTTAAGCTTTTGGTTAGAAAATTTGTATGGTTTCACCCTC
                      ____________________________________________________________
consensus GTAAACTCCAACCCCAAGTCCTTAAGCTTTTGGTTAGAAAATTTGTATGGTTTCACCCTC
 
. : . : . : . : . : . :
rJMSF024E03- GGCTTTATTTCGTCCGAACACTTGGTGGGGATAGGATACTCGGGAAAGAACTTGGCCAAA
                      ____________________________________________________________
consensus GGCTTTATTTCGTCCGAACACTTGGTGGGGATAGGATACTCGGGAAAGAACTTGGCCAAA
 
. : . : . : . : . : . :
rJMSF024E03- ATTTCAACCACATCGCCACGGTGAAGAACACTTTCGGCGCAGAGATAGCGGCCAGAAGCG
                      ____________________________________________________________
consensus ATTTCAACCACATCGCCACGGTGAAGAACACTTTCGGCGCAGAGATAGCGGCCAGAAGCG
 
. : . : . : . : . : . :
rJMSF024E03- GACGGGGTCTCGAAGAGGAGTATGTGAGCTAGGGCAACATCCTTAACATGCACATAAGCT
                      ____________________________________________________________
consensus GACGGGGTCTCGAAGAGGAGTATGTGAGCTAGGGCAACATCCTTAACATGCACATAAGCT
 
. : . : . : . : . : . :
rJMSF024E03- TGGACTGAATTGGCATAGGTTTTAGCAGAGCCAGTCAAGTACTTAAGGATGTGAAGAACA
JMFN009E13+ CATAAGTTTTAGCAGAGCCAGTGAGGTACTTGAGGATGTGAAGAATG
JMFN032J08+ AGGATGTGAAGAATG
                      ____________________________________________________________
consensus TGGACTGAATTGGCATAGGTTTTAGCAGAGCCAGTGAGGTACTTGAGGATGTGAAGAATG
 
. : . : . : . : . : . :
rJMSF024E03- CTTGCATTGATGGTGGGTTGTAGCAATGGCCCTAGCACCAATACTGGGTTGATCACCACC
JMFN009E13+ CTAGCATTGACTGTGGTTTGTAGCAATGGCCCAAGCACCAAAACTGGATTTATCACCACT
JMFN032J08+ CTAGCATTGACTGTGGTTTGTAGCAATGGCCCAAGCACCAAAACTGGATTTATCACCACT
                      ____________________________________________________________
consensus CTAGCATTGACTGTGGTTTGTAGCAATGGCCCAAGCACCAAAACTGGATTTATCACCACT
 
. : . : . : . : . : . :
rJMSF024E03- ACATCAACTCCCTTCTCCCTAGCCTCTTCCCATGCTGTTTTCTCTGCTACCATCTTCCCA
JMFN009E13+ AAATCAACCCCTCTCTCCTTTGCTTCTTCCCATGCTTTTTTCTCTGCCACCATCTTCCCA
JMFN032J08+ AAATCAACCCCTCTCTCCTTTGCTTCTTCCCATGCTTTTTTCTCTGCCACCATCTTCCCA
                      ____________________________________________________________
consensus AAATCAACCCCTCTCTCCTTTGCTTCTTCCCATGCTTTTTTCTCTGCCACCATCTTCCCA
 
. : . : . : . : . : . :
rJMSF024E03- TAGCAATACCAATTCTTTGTGCTTTTGCAAAAGTCAAGATCACTCCAACAAGTTTCGTCC
JMFN009E13+ TAACAATACCAATTCTTAGTGTTCTTGCAAAACTCAAGATCACTCCAACAAGTTTCATCC
JMFN032J08+ TAACAATACCAATTCTTAGTGTTCTTGCAAAACTCAAGATCACTCCAACAAGTTTCATCC
                      ____________________________________________________________
consensus TAACAATACCAATTCTTAGTGTTCTTGCAAAACTCAAGATCACTCCAACAAGTTTCATCC
 
. : . : . : . : . : . :
rJMSF024E03- ACAA
JMFN009E13+ ACAATTTCATCAGGGCCTCTGTTGGGGTCCATGTAGACCGCACCAATGGAGGAAGTGAAC
JMFN032J08+ ACAATTTCATCAGGGCCTCTGTTGGGGTCCATGTAGACCGCACCAATGGAGGAAGTGAAC
                      ____________________________________________________________
consensus ACAATTTCATCAGGGCCTCTGTTGGGGTCCATGTAGACCGCACCAATGGAGGAAGTGAAC
 
. : . : . : . : . : . :
JMFN009E13+ ACCACGCGGCGAACTCCGGCTTCCGCCGCCGCCGCTATCACGTTCTTGGTTCCGATCACC
JMFN032J08+ ACCACGCGGCGAACTCCGGCTTCCGCCGCCGCCGCTATCACGTTCTTGGTTCCGATCACC
                      ____________________________________________________________
consensus ACCACGCGGCGAACTCCGGCTTCCGCCGCCGCCGCTATCACGTTCTTGGTTCCGATCACC
 
. : . : . : . : . : . :
JMFN009E13+ GCCGGCTCCACCATTTGTTCAGGATCATCCGTTACAGGCGAAGCGGTGTGGAAAACTCCA
JMFN032J08+ GCCGGCTCCACCATTTGTTCAGGATCATCCGTTACAGGCGAAGCGGTGTGGAAAACTCCA
                      ____________________________________________________________
consensus GCCGGCTCCACCATTTGTTCAGGATCATCCGTTACAGGCGAAGCGGTGTGGAAAACTCCA
 
. : . : . : . : . : . :
JMFN009E13+ TCGCAGCCGTTGATGGCTTCGCCCATGCTCTTGTAATCAAGAAGGTCCGCCTTCCAAAGT
JMFN032J08+ TCGCAGCCGTTGATGGCTTCGCCCATGCTCTTGTAATCAAGAAGGTCCGCCTTCCAAAGT
                      ____________________________________________________________
consensus TCGCAGCCGTTGATGGCTTCGCCCATGCTCTTGTAATCAAGAAGGTCCGCCTTCCAAAGT
 
. : . : . : . : . : . :
JMFN009E13+ GTTAACCTTTCATTTGCTCCTTCAAGCTTCTTTAGGTGACCATTCTTTTCATCATCTGGG
JMFN032J08+ GTTAACCTTTCATTTGCTCCTTCAAGCTTCTTTAGGTGACCATTCTTTTCATCATCTGGG
                      ____________________________________________________________
consensus GTTAACCTTTCATTTGCTCCTTCAAGCTTCTTTAGGTGACCATTCTTTTCATCATCTGGG
 
. : . : . : . : . : . :
JMFN009E13+ TTTCTGACGGTTCCTCGGACGGTGTAGCCTTTCTGGAGGAGAAGTTTAACGAGCCAGGAA
JMFN032J08+ TTTCTGACGGTTCCTCGGACGGTGTAGCCTTTCTGGAGGAGAAGTTTAACGAGCCAGGAA
                      ____________________________________________________________
consensus TTTCTGACGGTTCCTCGGACGGTGTAGCCTTTCTGGAGGAGAAGTTTAACGAGCCAGGAA
 
. : . : . : . : . : . :
JMFN009E13+ GCGATGAAGCCTCCGGCGCCGGTGACGCAGA
JMFN032J08+ GCGATGAAGCCTCCGGCGCCGGTGACGCAGACGACTTGGCCGGAAATCGACGGCATGGTT
                      ____________________________________________________________
consensus GCGATGAAGCCTCCGGCGCCGGTGACGCAGACGACTTGGCCGGAAATCGACGGCATGGTT